Adducin 2 (ADD2) (NM_001185055) Human Untagged Clone

CAT#: SC328937

ADD2 (untagged)-Human adducin 2 (beta) (ADD2) transcript variant 6


  "NM_001185055" in other vectors (4)

Reconstitution Protocol

USD 590.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Anti-ADD2 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00

Other products for "Adducin 2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Adducin 2
Synonyms ADDB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328937 representing NM_001185055.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGCGCAGGAGAGTTCCAGGAGCGAATTGCAAACCCACCGGGAAAATGAGCGAAGAGACGGTCCCC
GAGGCTGCCTCGCCGCCGCCCCCGCAGGGGCAGCCTTACTTTGACCGCTTCTCAGAGGACGACCCCGAG
TACATGCGCCTTCGCAACCGGGCGGCGGACCTGCGGCAGGACTTCAACCTGATGGAGCAGAAGAAGCGC
GTCACCATGATCCTGCAGAGTCCCTCTTTCAGGGAGGAGCTGGAAGGCCTCATCCAGGAGCAGATGAAG
AAGGGGAACAACTCCTCCAACATCTGGGCCCTGCGACAGATCGCGGACTTCATGGCCAGCACCTCCCAC
GCAGTCTTCCCGACATCTTCCATGAATGTCTCCATGATGACGCCTATCAATGACCTCCACACAGCTGAC
TCCCTGAACCTGGCCAAAGGGGAGCGGCTCATGCGGTGCAAGATCAGCAGTGTCTACCGACTCCTGGAC
CTCTATGGCTGGGCCCAGCTGAGTGACACCTATGTCACGTTGAGAGTCAGCAAGGAGCAGGACCACTTC
CTGATCAGCCCTAAGGGAGTTTCTTGCAGTGAAGTCACAGCGTCCAGCCTGATCAAGGTGAACATTCTG
GGAGAGGTGGTGGAGAAGGGCAGCAGCTGCTTCCCAGTGGACACCACAGGCTTCTGTCTGCACTCGGCC
ATCTATGCAGCGAGGCCCGACGTGCGCTGCATCATCCACCTGCACACACCGGCCACAGCAGCGGTGTCG
GCCATGAAGTGGGGCCTCCTGCCTGTCTCCCACAATGCCCTGCTGGTGGGGGACATGGCCTATTATGAC
TTCAATGGGGAAATGGAGCAGGAAGCCGATCGGATCAACCTGCAGAAGTGCCTTGGACCCACCTGCAAG
ATCCTGGTGCTAAGAAACCATGGAGTGGTTGCTCTGGGTGACACGGTAGAGGAGGCATTTTACAAGATC
TTCCACCTGCAGGCTGCATGTGAGATACAGGTGTCGGCTCTGTCCAGTGCCGGGGGAGTGGAGAACCTC
ATCCTCCTGGAGCAGGAGAAGCACCGGCCCCATGAGGTGGGCTCCGTGCAGTGGGCCGGGAGCACCTTT
GGGCCTATGCAGAAGAGTCGGCTGGGGGAGCATGAGTTTGAGGCCCTCATGAGGATGCTGGACAACCTG
GGCTACAGAACAGGTTACACGTATCGCCACCCCTTTGTTCAAGAGAAAACCAAACACAAAAGTGAGGTG
GAGATTCCAGCCACGGTCACAGCCTTCGTGTTTGAGGAGGACGGTGCCCCGGTGCCCGCCCTGCGACAG
CATGCCCAGAAGCAGCAGAAGGAGAAGACCCGCTGGCTCAATACGCCCAACACCTACCTGCGGGTCAAT
GTGGCCGATGAGGTCCAGAGGAGCATGGGCAGCCCCCGACCCAAGACCACGTGGATGAAGGCTGACGAG
GTGGAGAAATCCAGCAGTGGCATGCCGATTCGCATCGAAAACCCAAACCAATTTGTGCCTCTCTATACT
GACCCCCAGGAAGTACTGGAGATGAGGAACAAGATTCGAGAACAAAACCGACAAGATGTGAAGTCAGCG
GGGCCTCAGTCCCAGCTCCTGGCGAGCGTCATTGCCGAGAAGAGCCGAAGCCCGGTAGAGCAGAGGCTG
CCCCTGACTGGCGGGGAAACGTGTTTGCCTTCGGGGTCTTCTGTGCCTGGGGCTGGGTTGCAGGACCCC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001185055
Insert Size 1728 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001185055.1
RefSeq Size 3707 bp
RefSeq ORF 1728 bp
Locus ID 119
UniProt ID P35612
Cytogenetics 2p13.3
MW 64.2 kDa
Gene Summary Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an upstream start codon, compared to variant 1. This variant also differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (f) has a distinct N-terminus and is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.