Glycogenin 2 (GYG2) (NM_001184703) Human Untagged Clone

CAT#: SC328706

GYG2 (untagged)-Human glycogenin 2 (GYG2) transcript variant 4


  "NM_001184703" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal antibody to GYG2 (glycogenin 2)
    • 100 ul

USD 625.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Glycogenin 2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Glycogenin 2
Synonyms GN-2; GN2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328706 representing NM_001184703.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGGAGACAGAGTTTCACCATGGTGCCCAGGCTGGTCTCGAACTCCTGAGGTCAAGCAATTCACCC
ACCTCAGCCTCCCAAAGTGCTGGAATGACAGTGACTGATCAGGCTTTTGTCACACTAGCCACCAATGAC
ATCTACTGCCAGGGCGCCCTGGTCCTGGGGCAGTCACTGAGGAGACACAGGCTGACGAGGAAGCTGGTG
GTGTTGATCACTCCTCAGGTGTCCAGCCTGCTCAGGGTCATCCTCTCGAAGGTGTTCGATGAAGTCATT
GAAGTGAATCTAATCGATAGTGCCGACTACATCCACCTGGCCTTTCTGAAGAGACCTGAGCTCGGGCTC
ACCCTCACCAAGCTTCACTGTTGGACTCTCACTCACTACAGCAAGTGTGTCTTCCTGGATGCAGACACT
CTGGTGCTGTCCAATGTCGATGAGCTGTTTGACAGGGGAGAGTTTTCTGCGGCCCCGGACCCCGGATGG
CCGGATTGCTTCAATAGCGGGGTGTTTGTCTTCCAGCCTTCTCTCCACACGCATAAACTCCTGCTACAG
CACGCCATGGAACACGGCAGCTTTGACGGGGCAGACCAAGGCTTACTGAATAGTTTCTTCAGGAACTGG
TCGACCACAGACATCCACAAGCACCTGCCGTTCATCTATAACTTGAGTAGTAACACGATGTACACTTAC
AGCCCTGCCTTCAAGCAATTCGGTTCCAGTGCAAAGGTCGTCCACTTTTTGGGGTCCATGAAACCTTGG
AACTACAAGTACAATCCACAGAGTGGCTCGGTGTTGGAGCAAGGCTCAGCGTCCAGCAGCCAGCACCAG
GCGGCATTCCTTCATCTCTGGTGGACGGTCTACCAGAACAACGTGCTGCCCCTTTATAAAAGCGTCCAA
GCGGGGGAAGCACGCGCGTCTCCTGGTCACACACTTTGCCACAGTGATGTGGGGGGGCCGTGTGCGGAT
TCAGCCTCTGGTGTTGGAGAGCCGTGTGAAAATTCAACACCCAGTGCGGGCGTGCCGTGTGCAAATTCA
CCACTGGGTTCTAACCAGCCTGCTCAGGGCCTTCCGGAGCCGACCCAGATAGTGGATGAGACCCTGTCC
CTACCTGAAGGACGCCGTTCAGAAGATGTCGACCTGGCCGTCTCTGTTTCCCAGATCTCCATCGAAGAG
AAGGTGAAGGAATTGAGCCCCGAGGAAGAGAGGAGGAAGTGGGAGGAAGGCCGTATCGACTACATGGGG
AAGGACGCGTTTGCTCGCATCCAGGAGAAGCTGGACCGGTTCCTGCAGTAA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001184703
Insert Size 1293 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001184703.1
RefSeq Size 3182 bp
RefSeq ORF 1293 bp
Locus ID 8908
UniProt ID O15488
Cytogenetics Xp22.33
MW 47.5 kDa
Gene Summary This gene encodes a member of the the glycogenin family. Glycogenin is a self-glucosylating protein involved in the initiation reactions of glycogen biosynthesis. A gene on chromosome 3 encodes the muscle glycogenin and this X-linked gene encodes the glycogenin mainly present in liver; both are involved in blood glucose homeostasis. This gene has a short version on chromosome Y, which is 3' truncated and can not make a functional protein. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, May 2010]
Transcript Variant: This variant (4) lacks two consecutive in-frame exons in the 3' CDS, as compared to variant 2. The resulting isoform (d) lacks an internal segment in the C-terminal region, as compared to isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.