ARL13B (NM_001174151) Human Untagged Clone

CAT#: SC328530

ARL13B (untagged)-Human ADP-ribosylation factor-like 13B (ARL13B) transcript variant 4


  "NM_001174151" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
ARL13B Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ARL13B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARL13B
Synonyms ARL2L1; JBTS8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328530 representing NM_001174151.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGAGACAAAAGAGGCTATGTCAGAAATGCTAAGACATCCTAGGATATCGGGAAAGCCTATATTG
GTGTTGGCAAATAAACAAGATAAAGAAGGAGCTTTAGGAGAAGCTGATGTCATTGAATGTCTATCTCTG
GAAAAATTGGTCAATGAGCACAAGTGCCTGTGTCAGATAGAACCATGTTCAGCAATCTCGGGGTATGGA
AAGAAAATTGACAAGTCCATTAAAAAAGGCCTTTATTGGCTGCTACATGTTATTGCAAGAGACTTTGAT
GCCTTAAATGAACGCATCCAAAAAGAGACAACAGAGCAGCGTGCTCTTGAGGAACAAGAGAAACAAGAA
AGAGCTGAACGAGTGCGAAAATTACGAGAAGAAAGAAAACAAAATGAACAGGAGCAGGCTGAACTCGAT
GGAACCAGTGGTCTGGCTGAGTTGGACCCAGAACCAACGAATCCTTTCCAGCCAATAGCATCTGTAATC
ATTGAGAATGAAGGAAAACTTGAAAGAGAGAAAAAAAACCAAAAAATGGAGAAAGACAGTGATGGCTGC
CACCTGAAACATAAAATGGAGCATGAGCAAATAGAGACACAAGGCCAGGTTAATCACAATGGCCAAAAA
AATAATGAATTTGGACTAGTAGAAAATTATAAGGAGGCATTAACACAGCAGTTAAAGAATGAAGATGAG
ACAGACCGGCCATCATTGGAATCAGCTAATGGTAAAAAGAAAACTAAGAAACTAAGAATGAAAAGGAAC
CACCGGGTAGAACCACTTAATATAGATGACTGTGCTCCTGAGAGTCCAACGCCACCCCCACCCCCTCCT
CCTGTTGGCTGGGGAACCCCTAAAGTCACTAGACTTCCAAAACTTGAGCCTCTTGGTGAAACACATCAT
AATGATTTCTATAGGAAGCCACTGCCTCCCCTGGCTGTGCCACAGCGACCTAACAGTGATGCTCATGAT
GTGATCTCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001174151
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001174151.1
RefSeq Size 3920 bp
RefSeq ORF 978 bp
Locus ID 200894
UniProt ID Q3SXY8
Cytogenetics 3q11.1-q11.2
MW 37.1 kDa
Gene Summary This gene encodes a member of the ADP-ribosylation factor-like family. The encoded protein is a small GTPase that contains both N-terminal and C-terminal guanine nucleotide-binding motifs. This protein is localized in the cilia and plays a role in cilia formation and in maintenance of cilia. Mutations in this gene are the cause of Joubert syndrome 8. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (4) differs in the 3' UTR, lacks an in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. The encoded isoform 3 has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.