CCRK (CDK20) (NM_001170640) Human Untagged Clone

CAT#: SC328392

CDK20 (untagged)-Human cyclin-dependent kinase 20 (CDK20) transcript variant 5


  "NM_001170640" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
CDK20 mouse monoclonal antibody,clone OTI1B3
    • 100 ul

USD 224.00 USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CDK20"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDK20
Synonyms CCRK; CDCH; P42; PNQALRE
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001170640, the custom clone sequence may differ by one or more nucleotides
ATGGACCAGTACTGCATCCTGGGCCGCATCGGGGAGGGCGCCCACGGCATCGTCTTCAAG
GCCAAGCACGTGGAGACTGGCGAGATAGTTGCCCTCAAGAAGGTGGCCCTAAGGCGGTTG
GAGGACGGCTTCCCTAACCAGGCCCTGCGGGAGATTAAGGCTCTGCAGGAGATGGAGGAC
AATCAGTATGTGGTACAACTGAAGGCTGTGTTCCCACACGGTGGAGGCTTTGTGCTGGCC
TTTGAGTTCATGCTGTCGGATCTGGCCGAGGTGGTGCGCCATGCCCAGAGGCCACTAGCC
CAGGCACAGGTCAAGAGCTACCTGCAGATGCTGCTCAAGGGTGTCGCCTTCTGCCATGCC
AACAACATTGTACATCGGGACCTGAAACCTGCCAACCTGCTCATCAGCGCCTCAGGCCAG
CTCAAGATAGCGGACTTTGGCCTGGCTCGAGTCTTTTCCCCAGACGGCAGCCGCCTCTAC
ACACACCAGGTGGCCACCAGGAGCTCACTGAGCTGCCGGACTACAACAAGATCTCCTTTA
AGGAGCAGGTGCCCATGCCCCTGGAGGAGGTGCTGCCTGACGTCTCTCCCCAGGCATTGG
ATCTGCTGGGTCAATTCCTTCTCTACCCTCCTCACCAGCGCATCGCAGCTTCCAAGGCTC
TCCTCCATCAGTACTTCTTCACAGCTCCCCTGCCTGCCCATCCATCTGAGCTGCCGATTC
CTCAGCGTCTAG
Restriction Sites Please inquire     
ACCN NM_001170640
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001170640.1, NP_001164111.1
RefSeq Size 2219 bp
RefSeq ORF 732 bp
Locus ID 23552
UniProt ID Q8IZL9
Cytogenetics 9q22.1
Protein Families Druggable Genome, Protein Kinase
Gene Summary The protein encoded by this gene contains a kinase domain most closely related to the cyclin-dependent protein kinases. The encoded kinase may activate cyclin-dependent kinase 2 and is involved in cell growth. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (5) uses an alternate in-frame splice site in the 5' coding region, and lacks an exon in the 3' coding region, which results in a frameshift compared to variant 1. This results in a shorter protein (isoform 5, also known as cardiac CCRK), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.