NUDT16 (NM_001171906) Human Untagged Clone

CAT#: SC328358

NUDT16 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 16 (NUDT16) transcript variant 1


  "NM_001171906" in other vectors (4)

Reconstitution Protocol

USD 330.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
NUDT16 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "NUDT16"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NUDT16
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001171906, the custom clone sequence may differ by one or more nucleotidesATGGCCGGAGCCCGCAGGCTGGAGCTAGGCGAGGCCCTGGCGCTGGGGTCGGGCTGGCGTCATGCGTGC
CACGCTCTCCTCTACGCGCCGGACCCTGGGATGCTCTTCGGCCGCATCCCGCTGCGCTACGCCATACTG
ATGCAGATGCGCTTCGATGGACGCCTGGGCTTCCCCGGCGGATTCGTGGACACGCAGGACAGAAGCCTA
GAGGACGGGCTGAACCGCGAGCTGCGCGAGGAGCTGGGCGAAGCGGCTGCCGCTTTCCGCGTGGAGCGC
ACTGACTACCGCAGCTCCCACGTCGGGTCAGGGCCACGCGTTGTGGCCCACTTCTATGCCAAGCGTCTG
ACGCTCGAGGAGCTGTTGGCTGTGGAGGCCGGCGCAACACGCGCCAAGGACCACGGGCTGGAGGTGGGA
CCAGCCTGGGACTCTGTCCCTTTCCCAATTTCCTCTTCTCCCAAAGCTTTCTCTCCCCCAAGAAAGCAT
CCCTGGAGAAAAGTCTTTGCCCCTCTGACCTTGCCCTCTCCCCAGCTTTCTTGGTGGAGTTGGGATCGT
GATCATCTATACTCTGAATTAGTACTGCCAACCTGGGCTTTCTGTAAAGGTCTTTCCCACCCTTTACCA
GGAGAGATCCTTTCTAGAACACACTCATCCATGTCTCTCTGCTGTTCCCTATTGACAGTGTGA

Restriction Sites SgfI-RsrII     
ACCN NM_001171906
Insert Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001171906.2
RefSeq Size 905 bp
RefSeq ORF 684 bp
Locus ID 131870
UniProt ID Q96DE0
Cytogenetics 3q22.1
MW 25.3 kDa
Gene Summary RNA-binding and decapping enzyme that catalyzes the cleavage of the cap structure of snoRNAs and mRNAs in a metal-dependent manner. Part of the U8 snoRNP complex that is required for the accumulation of mature 5.8S and 28S rRNA. Has diphosphatase activity and removes m7G and/or m227G caps from U8 snoRNA and leaves a 5'monophosphate on the RNA. Catalyzes also the cleavage of the cap structure on mRNAs. Does not hydrolyze cap analog structures like 7-methylguanosine nucleoside triphosphate (m7GpppG). Also hydrolysis m7G- and m227G U3-capped RNAs but with less efficiencies. Has broad substrate specificity with manganese or cobalt as cofactor and can act on various RNA species. Binds to the U8 snoRNA; metal is not required for RNA-binding. May play a role in the regulation of snoRNAs and mRNAs degradation. Acts also as a phosphatase; hydrolyzes the non-canonical purine nucleotides inosine diphosphate (IDP) and deoxyinosine diphosphate (dITP) as well as guanosine diphosphate (GDP), deoxyguanosine diphosphate (dGDP), xanthine diphosphate (XDP), inosine triphosphate (ITP) and deoxyinosine triphosphate (ITP) to their respective monophosphate derivatives and does not distinguish between the deoxy- and ribose forms (PubMed:20385596, PubMed:26121039). The order of activity with different substrates is IDP > dIDP >> GDP = dGDP > XDP = ITP = dITP (PubMed:20385596). Binds strongly to GTP, ITP and XTP. Participates in the hydrolysis of dIDP/IDP and probably excludes non-canonical purines from RNA and DNA precursor pools, thus preventing their incorporation into RNA and DNA and avoiding chromosomal lesions (PubMed:20385596).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.