Clathrin light chain (CLTA) (NM_001184761) Human Untagged Clone

CAT#: SC328263

CLTA (untagged)-Human clathrin light chain A (CLTA) transcript variant 5


  "NM_001184761" in other vectors (4)

Reconstitution Protocol

USD 330.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


CLTA mouse monoclonal antibody,clone OTI2D12
    • 100 ul

USD 447.00

Other products for "CLTA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CLTA
Synonyms LCA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001184761, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAGCTGGATCCGTTCGGCGCCCCTGCCGGCGCCCCTGGCGGTCCCGCGCTGGGG
AACGGAGTGGCCGGCGCCGGCGAAGAAGACCCGGCTGCGGCCTTCTTGGCGCAGCAAGAG
AGCGAGATTGCGGGCATCGAGAACGACGAGGCCTTCGCCATCCTGGACGGCGGCGCCCCC
GGGCCCCAGCCGCACGGCGAGCCGCCGGGGGGTCCGGATGCTGTTGATGGAGTAATGAAT
GGTGAATACTACCAGGAAAGTAATGGTCCAACAGACAGTTATGCAGCTATTTCACAAGTG
GATCGATTGCAGTCAGAGCCTGAAAGTATCCGTAAATGGAGAGAAGAACAAATGGAACGC
TTGGAAGCCCTTGATGCCAATTCTCGGAAGCAAGAAGCAGAGTGGAAAGAAAAGGCAATA
AAGGAGCTAGAAGAATGGTATGCAAGACAGGACGAGCAGCTACAGAAAACAAAAGCAAAC
AACAGCAGAAGAAGCCTTTGTAAATGA
Restriction Sites Please inquire     
ACCN NM_001184761
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001184761.1, NP_001171690.1
RefSeq Size 1151 bp
RefSeq ORF 507 bp
Locus ID 1211
Cytogenetics 9p13.3
Protein Pathways Endocytosis, Huntington's disease, Lysosome
Gene Summary Clathrin is a large, soluble protein composed of heavy and light chains. It functions as the main structural component of the lattice-type cytoplasmic face of coated pits and vesicles which entrap specific macromolecules during receptor-mediated endocytosis. This gene encodes one of two clathrin light chain proteins which are believed to function as regulatory elements. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, May 2010]
Transcript Variant: This variant (5) lacks two alternate in-frame exons and uses an alternate splice site in the 3' terminal exon that causes a translational frameshift compared to variant 2. These differences result in a shorter protein (isoform e), compared to isoform b.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.