Clathrin light chain (CLTA) (NM_001184762) Human Untagged Clone
CAT#: SC328260
CLTA (untagged)-Human clathrin light chain A (CLTA) transcript variant 6
"NM_001184762" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CLTA |
Synonyms | LCA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001184762, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAGCTGGATCCGTTCGGCGCCCCTGCCGGCGCCCCTGGCGGTCCCGCGCTGGGG AACGGAGTGGCCGGCGCCGGCGAAGAAGACCCGGCTGCGGCCTTCTTGGCGCAGCAAGAG AGCGAGATTGCGGGCATCGAGAACGACGAGGCCTTCGCCATCCTGGACGGCGGCGCCCCC GGGCCCCAGCCGCACGGCGAGCCGCCGGGGGGTCCGGATGCCAATTCTCGGAAGCAAGAA GCAGAGTGGAAAGAAAAGGCAATAAAGGAGCTAGAAGAATGGTATGCAAGACAGGACGAG CAGCTACAGAAAACAAAAGCAAACAACAGGGCAGCAGAAGAAGCCTTTGTAAATGACATT GACGAGTCGTCCCCAGGCACTGAGTGGGAACGGGTGGCCCGGCTGTGTGACTTTAACCCC AAGTCTAGCAAGCAGGCCAAAGATGTCTCCCGCATGCGCTCAGTCCTCATCTCCCTCAAG CAGGCCCCGCTGGTGCACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001184762 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001184762.1, NP_001171691.1 |
RefSeq Size | 1000 bp |
RefSeq ORF | 501 bp |
Locus ID | 1211 |
UniProt ID | P09496 |
Cytogenetics | 9p13.3 |
Protein Pathways | Endocytosis, Huntington's disease, Lysosome |
Gene Summary | Clathrin is a large, soluble protein composed of heavy and light chains. It functions as the main structural component of the lattice-type cytoplasmic face of coated pits and vesicles which entrap specific macromolecules during receptor-mediated endocytosis. This gene encodes one of two clathrin light chain proteins which are believed to function as regulatory elements. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, May 2010] Transcript Variant: This variant (6) lacks four alternate in-frame exons, compared to variant 2, resulting in a shorter protein (isoform f), compared to isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229622 | CLTA (Myc-DDK-tagged)-Human clathrin, light chain A (CLTA), transcript variant 6 |
USD 165.00 |
|
RC229622L3 | Lenti-ORF clone of CLTA (Myc-DDK-tagged)-Human clathrin, light chain A (CLTA), transcript variant 6 |
USD 465.00 |
|
RC229622L4 | Lenti-ORF clone of CLTA (mGFP-tagged)-Human clathrin, light chain A (CLTA), transcript variant 6 |
USD 465.00 |
|
RG229622 | CLTA (tGFP-tagged) - Human clathrin, light chain A (CLTA), transcript variant 6 |
USD 365.00 |
{0} Product Review(s)
Be the first one to submit a review