GOLGA7 (NM_001174124) Human Untagged Clone

CAT#: SC328207

GOLGA7 (untagged)-Human golgin A7 (GOLGA7) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GOLGA7
• Synonyms: GCP16; GOLGA3AP1; GOLGA7A; HSPC041
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC328207 representing NM_001174124.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGGCCGCAGCAGGCGCCGGTGTCCGGAAAGGTGTTCATTCAGCGAGACTACAGCAGTGGCACACGC
  TGCCAGTTCCAGACCAAGTTCCCTGCGGAGCTGGAGAACCGGATTGATAGGCAGCAGTTTGAAGAAACA
  GTTCGAACTCTAAATAACCTTTATGCAGAAGCAGAGAAGCTCGGCGGCCAGTCATATCTCGAAGGTTGT
  TTGGCTTGTTTAACAGCATATACCATCTTCCTATGCATGGAAACTCATTATGAGAAGGTTCTGAAGAAA
  GTCTCCAAATACATTCAAGAGCAGAATGAGAAGATCTATGCTCCACAAGGCCTCCTCCTGACAGACCCT
  ATTGAGCGAGGACTGCGAGTTTTTAGATTGAAATTACCATTTATGAAGACAGAGGCATGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001174124
• Insert Size: 405 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001174124.1
• RefSeq Size: 1924 bp
• RefSeq ORF: 405 bp
• Locus ID: 51125
• UniProt ID: Q7Z5G4
• Cytogenetics: 8p11.21
• MW: 15.6 kDa
• Gene Summary: May be involved in protein transport from Golgi to cell surface. The ZDHHC9-GOLGA7 complex is a palmitoyltransferase specific for HRAS and NRAS.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate splice site in the 3' coding region that results in a frameshift, compared to variant 2. The resulting isoform (b) has a shorter and distinct C-terminus, compared to isoform a.