GOLGA7 (NM_001174124) Human Untagged Clone
CAT#: SC328207
GOLGA7 (untagged)-Human golgin A7 (GOLGA7) transcript variant 3
"NM_001174124" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GOLGA7 |
Synonyms | GCP16; GOLGA3AP1; GOLGA7A; HSPC041 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328207 representing NM_001174124.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGGCCGCAGCAGGCGCCGGTGTCCGGAAAGGTGTTCATTCAGCGAGACTACAGCAGTGGCACACGC TGCCAGTTCCAGACCAAGTTCCCTGCGGAGCTGGAGAACCGGATTGATAGGCAGCAGTTTGAAGAAACA GTTCGAACTCTAAATAACCTTTATGCAGAAGCAGAGAAGCTCGGCGGCCAGTCATATCTCGAAGGTTGT TTGGCTTGTTTAACAGCATATACCATCTTCCTATGCATGGAAACTCATTATGAGAAGGTTCTGAAGAAA GTCTCCAAATACATTCAAGAGCAGAATGAGAAGATCTATGCTCCACAAGGCCTCCTCCTGACAGACCCT ATTGAGCGAGGACTGCGAGTTTTTAGATTGAAATTACCATTTATGAAGACAGAGGCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001174124 |
Insert Size | 405 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001174124.1 |
RefSeq Size | 1924 bp |
RefSeq ORF | 405 bp |
Locus ID | 51125 |
UniProt ID | Q7Z5G4 |
Cytogenetics | 8p11.21 |
MW | 15.6 kDa |
Gene Summary | May be involved in protein transport from Golgi to cell surface. The ZDHHC9-GOLGA7 complex is a palmitoyltransferase specific for HRAS and NRAS.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate splice site in the 3' coding region that results in a frameshift, compared to variant 2. The resulting isoform (b) has a shorter and distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229569 | GOLGA7 (Myc-DDK-tagged)-Human golgin A7 (GOLGA7), transcript variant 3 |
USD 505.00 |
|
RC229569L3 | Lenti ORF clone of Human golgin A7 (GOLGA7), transcript variant 3, Myc-DDK-tagged |
USD 805.00 |
|
RC229569L4 | Lenti ORF clone of Human golgin A7 (GOLGA7), transcript variant 3, mGFP tagged |
USD 805.00 |
|
RG229569 | GOLGA7 (tGFP-tagged) - Human golgin A7 (GOLGA7), transcript variant 3 |
USD 705.00 |
{0} Product Review(s)
Be the first one to submit a review