GLRA4 (NM_001024452) Human Untagged Clone

CAT#: SC327841

GLRA4 (untagged)-Human glycine receptor alpha 4 (GLRA4)


  "NM_001024452" in other vectors (5)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "GLRA4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GLRA4
Synonyms glycine receptor, alpha 4; glycine receptor, alpha 4 subunit; OTTHUMP00000023760
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001024452, the custom clone sequence may differ by one or more nucleotides


ATGACAACTCTTGTTCCTGCAACCCTCTCCTTCCTTCTTCTCTGGACCCTGCCAGGGCAGGTCCTCCTCA
GGGTGGCCTTGGCAAAAGAGGAAGTCAAATCTGGAACCAAGGGGTCCCAGCCCATGTCCCCCTCTGATTT
CCTAGACAAACTTATGGGGCGAACATCTGGATATGATGCCAGGATTCGGCCCAATTTTAAAGGCCCACCC
GTGAACGTGACCTGCAACATCTTCATCAACAGTTTCAGCTCCATCACCAAGACCACAATGGACTACCGGG
TGAATGTCTTCTTGCGGCAACAGTGGAATGACCCACGCCTGTCCTACCGAGAATATCCTGATGACTCTCT
GGACCTCGATCCCTCCATGCTGGACTCTATCTGGAAGCCAGACCTCTTCTTTGCTAATGAGAAAGGGGCC
AACTTCCATGAGGTGACCACGGACAACAAGTTACTGCGCATCTTCAAGAATGGGAATGTGCTGTACAGCA
TCAGGCTGACCCTCATTTTGTCCTGCCTGATGGACCTCAAGAACTTCCCCATGGACATCCAGACCTGCAC
GATGCAGCTTGAGAGCTTTGGCTACACCATGAAAGACCTCGTGTTTGAGTGGCTGGAAGATGCTCCTGCT
GTCCAAGTGGCTGAGGGGCTGACTCTGCCCCAGTTTATCTTGCGGGATGAGAAGGATCTAGGCTGTTGTA
CCAAGCACTACAACACAGGGAAATTCACCTGCATCGAGGTAAAGTTTCACCTGGAACGGCAGATGGGCTA
CTATCTGATTCAGATGTACATCCCCAGCCTACTCATCGTCATCCTGTCCTGGGTCTCCTTCTGGATCAAC
ATGGATGCTGCCCCTGCCCGTGTGGGCCTGGGCATCACCACCGTGCTCACCATGACCACCCAGAGCTCTG
GCTCCCGGGCCTCTTTGCCTAAGGTGTCCTACGTGAAGGCAATCGACATCTGGATGGCTGTGTGTCTGCT
CTTTGTGTTCGCTGCCTTGCTGGAGTATGCTGCCATAAATTTTGTTTCTCGTCAGCATAAAGAATTCATA
CGACTTCGAAGAAGGCAGAGGCGCCAACGCTTGGAGGAAGATATCATCCAAGAAAGTCGTTTCTATTTCC
GTGGCTATGGCTTGGGCCACTGCCTGCAGGCAAGAGATGGAGGTCCAATGGAAGGTTCTGGCATTTATAG
TCCCCAACCTCCAGCCCCTCTTCTAAGGGAAGGAGAAACCACGCGGAAACTCTACGTGGACTGA


Restriction Sites Please inquire     
ACCN NM_001024452
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001024452.2, NP_001019623.2
RefSeq Size 1675 bp
RefSeq ORF 1254 bp
Locus ID 441509
Cytogenetics Xq22.2
Protein Families Transmembrane
Gene Summary This gene encodes a glycine receptor and member of the ligand-gated ion channel family of proteins. The encoded protein is missing the fourth transmembrane region compared to related proteins in mouse and rat, and experimental data suggests that the human protein is functionally inactive. However, there is strong evidence to support transcription of this gene. As a result, RefSeq, in collaboration with Ensembl-GENCODE, has determined that this locus is best described as a transcribed pseudogene. [provided by RefSeq, Aug 2019]
Transcript Variant: This variant (1) represents the shorter transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.