GLRA4 (NM_001024452) Human Untagged Clone
CAT#: SC327841
GLRA4 (untagged)-Human glycine receptor alpha 4 (GLRA4)
"NM_001024452" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GLRA4 |
Synonyms | glycine receptor, alpha 4; glycine receptor, alpha 4 subunit; OTTHUMP00000023760 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001024452, the custom clone sequence may differ by one or more nucleotides
ATGACAACTCTTGTTCCTGCAACCCTCTCCTTCCTTCTTCTCTGGACCCTGCCAGGGCAGGTCCTCCTCA GGGTGGCCTTGGCAAAAGAGGAAGTCAAATCTGGAACCAAGGGGTCCCAGCCCATGTCCCCCTCTGATTT CCTAGACAAACTTATGGGGCGAACATCTGGATATGATGCCAGGATTCGGCCCAATTTTAAAGGCCCACCC GTGAACGTGACCTGCAACATCTTCATCAACAGTTTCAGCTCCATCACCAAGACCACAATGGACTACCGGG TGAATGTCTTCTTGCGGCAACAGTGGAATGACCCACGCCTGTCCTACCGAGAATATCCTGATGACTCTCT GGACCTCGATCCCTCCATGCTGGACTCTATCTGGAAGCCAGACCTCTTCTTTGCTAATGAGAAAGGGGCC AACTTCCATGAGGTGACCACGGACAACAAGTTACTGCGCATCTTCAAGAATGGGAATGTGCTGTACAGCA TCAGGCTGACCCTCATTTTGTCCTGCCTGATGGACCTCAAGAACTTCCCCATGGACATCCAGACCTGCAC GATGCAGCTTGAGAGCTTTGGCTACACCATGAAAGACCTCGTGTTTGAGTGGCTGGAAGATGCTCCTGCT GTCCAAGTGGCTGAGGGGCTGACTCTGCCCCAGTTTATCTTGCGGGATGAGAAGGATCTAGGCTGTTGTA CCAAGCACTACAACACAGGGAAATTCACCTGCATCGAGGTAAAGTTTCACCTGGAACGGCAGATGGGCTA CTATCTGATTCAGATGTACATCCCCAGCCTACTCATCGTCATCCTGTCCTGGGTCTCCTTCTGGATCAAC ATGGATGCTGCCCCTGCCCGTGTGGGCCTGGGCATCACCACCGTGCTCACCATGACCACCCAGAGCTCTG GCTCCCGGGCCTCTTTGCCTAAGGTGTCCTACGTGAAGGCAATCGACATCTGGATGGCTGTGTGTCTGCT CTTTGTGTTCGCTGCCTTGCTGGAGTATGCTGCCATAAATTTTGTTTCTCGTCAGCATAAAGAATTCATA CGACTTCGAAGAAGGCAGAGGCGCCAACGCTTGGAGGAAGATATCATCCAAGAAAGTCGTTTCTATTTCC GTGGCTATGGCTTGGGCCACTGCCTGCAGGCAAGAGATGGAGGTCCAATGGAAGGTTCTGGCATTTATAG TCCCCAACCTCCAGCCCCTCTTCTAAGGGAAGGAGAAACCACGCGGAAACTCTACGTGGACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001024452 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001024452.2, NP_001019623.2 |
RefSeq Size | 1675 bp |
RefSeq ORF | 1254 bp |
Locus ID | 441509 |
Cytogenetics | Xq22.2 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a glycine receptor and member of the ligand-gated ion channel family of proteins. The encoded protein is missing the fourth transmembrane region compared to related proteins in mouse and rat, and experimental data suggests that the human protein is functionally inactive. However, there is strong evidence to support transcription of this gene. As a result, RefSeq, in collaboration with Ensembl-GENCODE, has determined that this locus is best described as a transcribed pseudogene. [provided by RefSeq, Aug 2019] Transcript Variant: This variant (1) represents the shorter transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229206 | GLRA4 (Myc-DDK-tagged)-Human glycine receptor, alpha 4 (GLRA4), transcript variant 1 |
USD 686.00 |
|
RC229206L3 | Lenti ORF clone of Human glycine receptor, alpha 4 (GLRA4), transcript variant 1, Myc-DDK-tagged |
USD 986.00 |
|
RC229206L4 | Lenti ORF clone of Human glycine receptor, alpha 4 (GLRA4), transcript variant 1, mGFP tagged |
USD 986.00 |
|
RG229206 | GLRA4 (tGFP-tagged) - Human glycine receptor, alpha 4 (GLRA4), transcript variant 1 |
USD 886.00 |
|
SC317080 | GLRA4 (untagged)-Human glycine receptor, alpha 4 (GLRA4), transcript variant 1 |
USD 732.00 |
{0} Product Review(s)
Be the first one to submit a review