PYCR3 (NM_023078) Human Untagged Clone

CAT#: SC327776

PYCRL (untagged)-Human pyrroline-5-carboxylate reductase-like (PYCRL)


  "NM_023078" in other vectors (5)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PYCRL mouse monoclonal antibody, clone OTI1B12 (formerly 1B12)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PYCR3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PYCR3
Synonyms PYCRL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC327776 representing NM_023078.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCGGTGAGCGCAGCGGCGTCCGAGGCAACAAGATGGCAGCTGCGGAGCCGTCTCCGCGGCGCGTG
GGCTTCGTGGGCGCGGGCCGCATGGCGGGGGCCATCGCGCAGGGCCTCATCAGAGCAGGAAAAGTGGAA
GCTCAGCACATACTGGCCAGTGCACCAACAGACAGGAACCTATGTCACTTTCAAGCTCTGGGTTGCCGG
ACCACGCACTCCAACCAGGAGGTGCTGCAGAGCTGCCTGCTCGTCATCTTTGCCACCAAGCCTCATGTG
CTGCCAGCTGTCCTGGCAGAGGTGGCTCCTGTGGTCACCACTGAACACATCTTGGTGTCCGTGGCTGCT
GGGGTGTCTCTGAGCACCCTGGAGGAGCTGCTGCCCCCAAACACACGGGTGCTGCGGGTCTTGCCCAAC
CTGCCCTGTGTGGTCCAGGAAGGGGCCATAGTGATGGCGCGGGGCCGCCACGTGGGGAGCAGCGAGACC
AAGCTCCTGCAGCATCTGCTGGAGGCCTGTGGGCGGTGTGAGGAGGTGCCTGAAGCCTACGTCGACATC
CACACTGGCCTCAGTGGCAGTGGCGTGGCCTTCGTGTGTGCATTCTCCGAGGCCCTGGCTGAAGGAGCC
GTCAAGATGGGCATGCCCAGCAGCCTGGCCCACCGCATCGCTGCCCAGACCCTGCTGGGGACGGCCAAG
ATGCTGCTGCACGAGGGCCAACACCCAGCCCAGCTGCGCTCAGACGTGTGCACCCCGGGTGGCACCACC
ATCTATGGACTCCACGCCCTGGAGCAGGGCGGGCTGCGAGCAGCCACCATGAGCGCCGTGGAGGCTGCC
ACCTGCCGGGCCAAGGAGCTCAGCAGAAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_023078
Insert Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_023078.3
RefSeq Size 2678 bp
RefSeq ORF 861 bp
Locus ID 65263
UniProt ID Q53H96
Cytogenetics 8q24.3
Domains P5CR
Protein Pathways Arginine and proline metabolism, Metabolic pathways
MW 29.9 kDa
Gene Summary This gene encodes a protein that belongs to the pyrroline-5-carboxylate reductase family of enzymes. Members of this family catalyze the final step in proline biosynthesis, converting pyrroline-5-carboxylate to proline. Glutamate and ornithine are precursors in the synthesis of proline. The protein encoded by this gene is a cytoplasmic enzyme involved in the biosynthesis of proline from ornithine. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.