GPR85 (NM_001146266) Human Untagged Clone
CAT#: SC327485
GPR85 (untagged)-Human G protein-coupled receptor 85 (GPR85) transcript variant 3
"NM_001146266" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GPR85 |
Synonyms | SREB; SREB2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001146266, the custom clone sequence may differ by one or more nucleotides
ATGGCGAACTATAGCCATGCAGCTGACAACATTTTGCAAAATCTCTCGCCTCTAACAGCC TTTCTGAAACTGACTTCCTTGGGTTTCATAATAGGAGTCAGCGTGGTGGGCAACCTCCTG ATCTCCATTTTGCTAGTGAAAGATAAGACCTTGCATAGAGCACCTTACTACTTCCTGTTG GATCTTTGCTGTTCAGATATCCTCAGATCTGCAATTTGTTTCCCATTTGTGTTCAACTCT GTCAAAAATGGTTCTACCTGGACTTATGGGACTCTGACTTGCAAAGTGATTGCCTTTCTG GGGGTTTTGTCCTGTTTCCACACTGCTTTCATGCTCTTCTGCATCAGTGTCACCAGATAC TTAGCTATCGCCCATCACCGCTTCTATACAAAGAGGCTGACCTTTTGGACGTGTCTGGCT GTGATCTGTATGGTGTGGACTCTGTCTGTGGCCATGGCATTTCCCCCGGTTTTAGACGTG GGCACTTACTCATTCATTAGGGAGGAAGATCAATGCACCTTCCAACACCGCTCCTTCAGG GCTAATGATTCCTTAGGATTTATGCTGCTTCTTGCTCTCATCCTCCTAGCCACACAGCTT GTCTACCTCAAGCTGATATTTTTCGTCCACGATCGAAGAAAAATGAAGCCAGTCCAGTTT GTAGCAGCAGTCAGCCAGAACTGGACTTTTCATGGTCCTGGAGCCAGTGGCCAGGCAGCT GCCAATTGGCTAGCAGGATTTGGAAGGGGTCCCACACCACCCACCTTGCTGGGCATCAGG CAAAATGCAAACACCACAGGCAGAAGAAGGCTATTGGTCTTAGACGAGTTCAAAATGGAG AAAAGAATCAGCAGAATGTTCTATATAATGACTTTTCTGTTTCTAACCTTGTGGGGCCCC TACCTGGTGGCCTGTTATTGGAGAGTTTTTGCAAGAGGGCCTGTAGTACCAGGGGGATTT CTAACAGCTGCTGTCTGGATGAGTTTTGCCCAAGCAGGAATCAATCCTTTTGTCTGCATT TTCTCAAACAGGGAGCTGAGGCGCTGTTTCAGCACAACCCTTCTTTACTGCAGAAAATCC AGGTTACCAAGGGAACCTTACTGTGTTATA |
Restriction Sites | Please inquire |
ACCN | NM_001146266 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001146266.1, NP_001139738.1 |
RefSeq Size | 4841 bp |
RefSeq ORF | 1113 bp |
Locus ID | 54329 |
UniProt ID | P60893 |
Cytogenetics | 7q31.1 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Gene Summary | Members of the G protein-coupled receptor (GPCR) family, such as GPR85, have a similar structure characterized by 7 transmembrane domains. Activation of GPCRs by extracellular stimuli, such as neurotransmitters, hormones, or light, induces an intracellular signaling cascade mediated by heterotrimeric GTP-binding proteins, or G proteins (Matsumoto et al., 2000 [PubMed 10833454]).[supplied by OMIM, Aug 2008] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All variants (1-4) encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228850 | GPR85 (Myc-DDK-tagged)-Human G protein-coupled receptor 85 (GPR85), transcript variant 3 |
USD 457.00 |
|
RC228850L3 | Lenti-ORF clone of GPR85 (Myc-DDK-tagged)-Human G protein-coupled receptor 85 (GPR85), transcript variant 3 |
USD 757.00 |
|
RC228850L4 | Lenti-ORF clone of GPR85 (mGFP-tagged)-Human G protein-coupled receptor 85 (GPR85), transcript variant 3 |
USD 757.00 |
|
RG228850 | GPR85 (tGFP-tagged) - Human G protein-coupled receptor 85 (GPR85), transcript variant 3 |
USD 657.00 |
{0} Product Review(s)
Be the first one to submit a review