NEK6 (NM_001166170) Human Untagged Clone

CAT#: SC327454

NEK6 (untagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6) transcript variant 6


  "NM_001166170" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
NEK6 mouse monoclonal antibody, clone OTI5D7 (formerly 5D7)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "NEK6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NEK6
Synonyms SID6-1512
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC327454 representing NM_001166170.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGGACAGCCCGGCCACATGCCCCATGGAGGGAGTTCCAACAACCTCTGCCACACCCTGGGGCCT
GTGCATCCTCCTGACCCACAGAGGCATCCCAACACGCTGTCTTTTCGCTGCTCGCTGGCGGACTTCCAG
ATCGAAAAGAAGATAGGCCGAGGACAGTTCAGCGAGGTGTACAAGGCCACCTGCCTGCTGGACAGGAAG
ACAGTGGCTCTGAAGAAGGTGCAGATCTTTGAGATGATGGACGCCAAGGCGAGGCAGGACTGTGTCAAG
GAGATCGGCCTCTTGAAGCAACTGAACCACCCAAATATCATCAAGTATTTGGACTCGTTTATCGAAGAC
AACGAGCTGAACATTGTGCTGGAGTTGGCTGACGCAGGGGACCTCTCGCAGATGATCAAGTACTTTAAG
AAGCAGAAGCGGCTCATCCCGGAGAGGACAGTATGGAAGTACTTTGTGCAGCTGTGCAGCGCCGTGGAG
CACATGCATTCACGCCGGGTGATGCACCGAGACATCAAGCCTGCCAACGTGTTCATCACAGCCACGGGC
GTCGTGAAGCTCGGTGACCTTGGTCTGGGCCGCTTCTTCAGCTCTGAGACCACCGCAGCCCACTCCCTA
GTGGGGACGCCCTACTACATGTCACCGGAGAGGATCCATGAGAACGGCTACAACTTCAAGTCCGACATC
TGGTCCCTGGGCTGTCTGCTGTACGAGATGGCAGCCCTCCAGAGCCCCTTCTATGGAGATAAGATGAAT
CTCTTCTCCCTGTGCCAGAAGATCGAGCAGTGTGACTACCCCCCACTCCCCGGGGAGCACTACTCCGAG
AAGTTACGAGAACTGGTCAGCATGTGCATCTGCCCTGACCCCCACCAGAGACCTGACATCGGATACGTG
CACCAGGTGGCCAAGCAGATGCACATCTGGATGTCCAGCACCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001166170
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001166170.1
RefSeq Size 2594 bp
RefSeq ORF 942 bp
Locus ID 10783
UniProt ID Q9HC98
Cytogenetics 9q33.3
Protein Families Druggable Genome, Protein Kinase
MW 35.7 kDa
Gene Summary The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Variants 2, 5 and 6 encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.