NAT1 (NM_001160173) Human Untagged Clone
CAT#: SC327446
NAT1 (untagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1) transcript variant 4
"NM_001160173" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NAT1 |
Synonyms | AAC1; MNAT; NAT-1; NATI |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001160173, the custom clone sequence may differ by one or more nucleotides
ATGGACATTGAAGCATATCTTGAAAGAATTGGCTATAAGAAGTCTAGGAACAAATTGGAC TTGGAAACATTAACTGACATTCTTCAACACCAGATCCGAGCTGTTCCCTTTGAGAACCTT AACATCCATTGTGGGGATGCCATGGACTTAGGCTTAGAGGCCATTTTTGATCAAGTTGTG AGAAGAAATCGGGGTGGATGGTGTCTCCAGGTCAATCATCTTCTGTACTGGGCTCTGACC ACTATTGGTTTTGAGACCACGATGTTGGGAGGGTATGTTTACAGCACTCCAGCCAAAAAA TACAGCACTGGCATGATTCACCTTCTCCTGCAGGTGACCATTGATGGCAGGAACTACATT GTCGATGCTGGGTTTGGACGCTCATACCAGATGTGGCAGCCTCTGGAGTTAATTTCTGGG AAGGATCAGCCTCAGGTGCCTTGTGTCTTCCGTTTGACGGAAGAGAATGGATTCTGGTAT CTAGACCAAATCAGAAGGGAACAGTACATTCCAAATGAAGAATTTCTTCATTCTGATCTC CTAGAAGACAGCAAATACCGAAAAATCTACTCCTTTACTCTTAAGCCTCGAACAATTGAA GATTTTGAGTCTATGAATACATACCTGCAGACATCTCCATCATCTGTGTTTACTAGTAAA TCATTTTGTTCCTTGCAGACCCCAGATGGGGTTCACTGTTTGGTGGGCTTCACCCTCACC CATAGGAGATTCAATTATAAGGACAATACAGATCTAATAGAGTTCAAGACTCTGAGTGAG GAAGAAATAGAAAAAGTGCTGAAAAATATATTTAATATTTCCTTGCAGAGAAAGCTTGTG CCCAAACATGGTGATAGATTTTTTACTATT |
Restriction Sites | Please inquire |
ACCN | NM_001160173 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001160173.1, NP_001153645.1 |
RefSeq Size | 1965 bp |
RefSeq ORF | 873 bp |
Locus ID | 9 |
UniProt ID | P18440 |
Cytogenetics | 8p22 |
Protein Pathways | Caffeine metabolism, Drug metabolism - other enzymes, Metabolic pathways |
Gene Summary | This gene is one of two arylamine N-acetyltransferase (NAT) genes in the human genome, and is orthologous to the mouse and rat Nat2 genes. The enzyme encoded by this gene catalyzes the transfer of an acetyl group from acetyl-CoA to various arylamine and hydrazine substrates. This enzyme helps metabolize drugs and other xenobiotics, and functions in folate catabolism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (4, also known as Type IIC) lacks an alternate exon in the 5' UTR, compared to variant 1. This variant is transcribed from a promoter known as P1, promoter 2, or NATb promoter. Variants 1-6 and 9 all encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228811 | NAT1 (Myc-DDK-tagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 4 |
USD 300.00 |
|
RC228811L3 | Lenti-ORF clone of NAT1 (Myc-DDK-tagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 4 |
USD 600.00 |
|
RC228811L4 | Lenti-ORF clone of NAT1 (mGFP-tagged)-Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 4 |
USD 600.00 |
|
RG228811 | NAT1 (tGFP-tagged) - Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 4 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review