COPS7A (NM_001164095) Human Untagged Clone

CAT#: SC327427

COPS7A (untagged)-Human COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) (COPS7A) transcript variant 3


  "NM_001164095" in other vectors (4)

Reconstitution Protocol

USD 330.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


COPS7A rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "COPS7A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol COPS7A
Synonyms CSN7; CSN7A; SGN7a
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001164095, the custom clone sequence may differ by one or more nucleotides
ATGAGTGCGGAAGTGAAGGTGACAGGGCAGAACCAGGAGCAATTTCTGCTCCTAGCCAAG
TCGGCCAAGGGGGCAGCGCTGGCCACACTCATCCATCAGGTGCTGGAGGCCCCTGGTGTC
TACGTGTTTGGAGAACTGCTGGACATGCCCAATGTTAGAGAGCTGGCTGAGAGTGACTTT
GCCTCTACCTTCCGGCTGCTCACAGTGTTTGCTTATGGGACATACGCTGACTACTTAGCT
GAAGCCCGGAATCTTCCTCCACTAACAGAGGCTCAGAAGAATAAGCTTCGACACCTCTCA
GTTGTCACCCTGGCTGCTAAAGTAAAGTGTATCCCATATGCAGTGTTGCTGGAGGCTCTT
GCCCTGCGTAATGTGCGGCAGCTGGAAGACCTTGTGATTGAGGCTGTGTATGCTGACGTG
CTTCGTGGCTCCCTGGACCAGCGCAACCAGCGGCTCGAGGTTGACTACAGCATCGGGCGG
GACATCCAGCGCCAGGACCTCAGTGCCATTGCCCGAACCCTGCAGGAATGGTGTGTGGGC
TGTGAGGTCGTGCTGTCAGGCATTGAGGAGCAGGTGAGCCGTGCCAACCAACACAAGGAG
CAGCAGCTGGGCCTGAAGCAGCAGATTGAGAGTGAGGTTGCCAACCTTAAAAAAACCATT
AAAGTTACGACGGCAGCAGCAGCCGCAGCCACATCTCAGGACCCTGAGCAACACCTGACT
GAGCTGAGGGAACCAGCTCCTGGCACCAACCAGCGCCAGCCCAGCAAGAAAGCCTCAAAG
GGCAAGGGGCTCCGAGGGAGCGCCAAGATTTGGTCCAAGTCGAAT
Restriction Sites Please inquire     
ACCN NM_001164095
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001164095.1, NP_001157567.1
RefSeq Size 1895 bp
RefSeq ORF 828 bp
Locus ID 50813
UniProt ID Q9UBW8
Cytogenetics 12p13.31
Gene Summary This gene encodes a component of the COP9 signalosome, an evolutionarily conserved multi-subunit protease that regulates the activity of the ubiquitin conjugation pathway. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1-4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.