EBNA1 binding protein 2 (EBNA1BP2) (NM_001159936) Human Untagged Clone

CAT#: SC326927

EBNA1BP2 (untagged)-Human EBNA1 binding protein 2 (EBNA1BP2) transcript variant 1


  "NM_001159936" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit monoclonal anti-EBP2 antibody for SISCAPA, clone OTIR3D2
    • 100 ul

USD 516.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "EBNA1 binding protein 2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EBNA1 binding protein 2
Synonyms EBP2; NOBP; P40
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001159936 edited
ATGTATCCAGAGGCGCTACCTGTAGGGATCCTAAGCAACCCGGACACTTTCAAACGCCGT
AGCGGTTCCTATAGCAACGACAAACCGGAAGTATGGTTTGCCGCCGGAAGCGGAAGTCCC
AATCAAAAGTTGAGCAGTAGCTGTGTGGGACGTGCGTGCGGCGAGATGGACACTCCCCCG
CTCTCGGATTCGGAGTCGGAATCCGATGAATCCCTTGTCACAGACAGAGAGTTGCAGGAT
GCGTTTTCCCGAGGGCTTCTGAAGCCAGGCCTCAATGTCGTGCTAGAGGGGCCGAAGAAG
GCCGTGAACGACGTGAATGGCCTGAAGCAATGTTTGGCAGAATTCAAGCGGGATCTGGAA
TGGGTTGAAAGGCTCGATGTGACACTGGGTCCGGTACCGGAGATCGGTGGATCTGAGGCG
CCAGCACCTCAGAACAAGGACCAGAAAGCTGTTGATCCAGAAGACGACTTCCAGCGAGAG
ATGAGTTTCTATCGCCAAGCCCAGGCCGCAGTGCTTGCAGTCTTACCCCGCCTCCATCAG
CTCAAAGTCCCTACGAAGCGACCCACTGATTATTTTGCGGAAATGGCCAAATCTGATCTG
CAGATGCAGAAGATTCGACAGAAGCTGCAGACTAAACAGGCTGCCATGGAGAGGTCTGAA
AAAGCTAAGCAACTGCGAGCACTTAGGAAATACGGGAAGAAGGTGCAAACGGAGGTTCTT
CAGAAGAGGCAGCAGGAGAAAGCCCATATGATGAATGCTATTAAGAAATATCAGAAAGGC
TTCTCTGATAAACTGGATTTCCTTGAGGGAGATCAGAAACCTCTGGCACAGCGCAAGAAG
GCAGGAGCCAAAGGCCAGCAGATGAGGAAGGGGCCCAGTGCTAAACGACGGTATAAAAAC
CAGAAGTTTGGTTTTGGTGGAAAGAAGAAAGGCTCAAAGTGGAACACTCGGGAGAGCTAT
GATGATGTATCTAGCTTCCGGGCCAAGACAGCTCATGGCAGAGGCCTCAAGAGGCCTGGC
AAGAAAGGGTCAAATAAGAGACCGGGAAAACGAACAAGAGAGAAGATGAAGAACAGAACA
CACTAAATAGCATCTTTGAATACAAAGAACCAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001159936
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001159936.1, NP_001153408.1
RefSeq Size 1514 bp
RefSeq ORF 1086 bp
Locus ID 10969
UniProt ID Q99848
Cytogenetics 1p34.2
Gene Summary Required for the processing of the 27S pre-rRNA.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.