TYW3 (NM_001162916) Human Untagged Clone

CAT#: SC326793

TYW3 (untagged)-Human tRNA-yW synthesizing protein 3 homolog (S. cerevisiae) (TYW3) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TYW3
• Synonyms: C1orf171
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC326793 representing NM_001162916.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGATCGCAGCGCGGAGTTCAGGAAATGGAAGGCGCAATGTTTGAGCAAAGCGGACCTCAGCCGGAAG
  GGCAGTGTTGACGAGGATGTGGTAGAGCTTGTGCAGTTTCTGAACATGCGAGATCAGTTTTTCACCACC
  AGCTCCTGCGCTGGCCGCATCCTACTCCTTGACCGGGGTATAAATGGTTTTGAGGTTCAGAAACAAAAC
  TGTTGCTGGCTACTGGTTACACACAAACTTTGTGTAAAAGATGATGTGCATTCCATGGCAATAGATTCT
  GGTTTCAGGAACTCTGGCATAACGGTGGGAAAGAGAGGAAAAACTATGTTGGCTGTCCGGAGTACACAT
  GGCTTAGAAGTTCCATTAAGCCATAAGGGAAAACTGATGGTGACAGAGGAATATATTGACTTCCTGTTA
  AATGTGGCAAATCAAAAAATGGAGGAAAACAAGAAAAGAATTGAGAGGTTTTACAACTGCCTACAGCAT
  GCTTTGGAAAGGGAAACGATGACTAACTTACATCCCAAGATCAAAGAGAAAAATAACTCATCATATATT
  CATAAGAAAAAAAGAAACCCAGAAAAAACACGTGCCCAGTGTATTACTAAAGAAAGTGATGAAGAACTT
  GAAAATGATGATGATGATGATCTAGGAATCAATGTTACCATCTTCCCTGAAGATTACTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001162916
• Insert Size: 681 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001162916.1
• RefSeq Size: 3353 bp
• RefSeq ORF: 681 bp
• Locus ID: 127253
• UniProt ID: Q6IPR3
• Cytogenetics: 1p31.1
• MW: 26.1 kDa
• Gene Summary: Wybutosine (yW) is a hypermodified guanosine at the 3-prime position adjacent to the anticodon of phenylalanine tRNA that stabilizes codon-anticodon interactions during decoding on the ribosome. TYW3 is the human homolog of a yeast gene essential for yW synthesis (Noma and Suzuki, 2006).[supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (2) lacks an in-frame exon in the CDS, as compared to variant 1. The resulting isoform (2) lacks an internal segment, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.