Guanylate kinase (GUK1) (NM_001159390) Human Untagged Clone

CAT#: SC326784

GUK1 (untagged)-Human guanylate kinase 1 (GUK1) transcript variant 1


  "NM_001159390" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
GUK1 (Guanylate Kinase 1) mouse monoclonal antibody, clone OTI4A8 (formerly 4A8)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Guanylate kinase"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Guanylate kinase
Synonyms GMK
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001159390, the custom clone sequence may differ by one or more nucleotides
ATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACCGGAC
GGCATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC
AAGGAGCCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCA
GAGCTGAAGGAGGCGCTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCC
Restriction Sites Please inquire     
ACCN NM_001159390
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001159390.1, NP_001152862.1
RefSeq Size 990 bp
RefSeq ORF 657 bp
Locus ID 2987
UniProt ID Q16774
Cytogenetics 1q42.13
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
Gene Summary The protein encoded by this gene is an enzyme that catalyzes the transfer of a phosphate group from ATP to guanosine monophosphate (GMP) to form guanosine diphosphate (GDP). The encoded protein is thought to be a good target for cancer chemotherapy. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (1) contains an alternate coding exon in the 3' end compared to variant 5, that causes a frameshift. The resulting isoform (a) has a shorter and distinct C-terminus compared to isoform c.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.