Aph 1b (APH1B) (NM_001145646) Human Untagged Clone

CAT#: SC326540

APH1B (untagged)-Human anterior pharynx defective 1 homolog B (C. elegans) (APH1B), transcript variant 2, mRNA


  "NM_001145646" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-APH1B Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Aph 1b"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Aph 1b
Synonyms APH-1B; PRO1328; PSFL; TAAV688
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326540 representing NM_001145646.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACTGCGGCCGTGTTCTTCGGCTGCGCCTTCATTGCCTTCGGGCCTGCGCTCGCCCTTTATGTCTTC
ACCATCGCCACCGAGCCGTTGCGTATCATCTTCCTCATCGCCGGAGCTTTCTTCTGGTTGGTGTCTCTA
CTGATTTCGTCCCTTGTTTGGTTCATGGCAAGAGTCATTATTGACAACAAAGATGGACCAACACAGAAA
TATCTGCTGATCTTTGGAGCGTTTGTCTCTGTCTATATCCAAGAAATGTTCCGATTTGCATATTATAAA
CTCTTAAAAAAAGCCAGTGAAGGTTTGAAGAGTATAAACCCAGGTGAGACAGCACCCTCTATGCGACTG
CTGGCCTATGCTTTCATGACGCTGGTCATTATCTTGCTGCATGTATTCTGGGGCATTGTATTTTTTGAT
GGCTGTGAGAAGAAAAAGTGGGGCATCCTCCTTATCGTTCTCCTGACCCACCTGCTGGTGTCAGCCCAG
ACCTTCATAAGTTCTTATTATGGAATAAACCTGGCGTCAGCATTTATAATCCTGGTGCTCATGGGCACC
TGGGCATTCTTAGCTGCGGGAGGCAGCTGCCGAAGCCTGAAACTCTGCCTGCTCTGCCAAGACAAGAAC
TTTCTTCTTTACAACCAGCGCTCCAGATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145646
Insert Size 651 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145646.1
RefSeq Size 4082 bp
RefSeq ORF 651 bp
Locus ID 83464
UniProt ID Q8WW43
Cytogenetics 15q22.2
Protein Families Transmembrane
MW 24.3 kDa
Gene Summary This gene encodes a multi-pass transmembrane protein that is a functional component of the gamma-secretase complex, which also contains presenilin and nicastrin. This protein represents a stabilizing cofactor for the presenilin holoprotein in the complex. The gamma-secretase complex catalyzes the cleavage of integral proteins such as notch receptors and beta-amyloid precursor protein. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) lacks an in-frame coding exon and encodes a shorter isoform (2), as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.