Troponin I fast skeletal muscle (TNNI2) (NM_001145829) Human Untagged Clone

CAT#: SC326450

TNNI2 (untagged)-Human troponin I type 2 (skeletal, fast) (TNNI2), transcript variant 2, mRNA


  "NM_001145829" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TNNI2 mouse monoclonal antibody, clone OTI3A11 (formerly 3A11), Biotinylated
    • 100 ul

USD 509.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Troponin I fast skeletal muscle"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Troponin I fast skeletal muscle
Synonyms AMCD2B; DA2B; DA2B1; FSSV; fsTnI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326450 representing NM_001145829.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGAGATGAGGAGAAGCGGAACAGGGCCATCACGGCCCGCAGGCAGCACCTGAAGAGTGTGATGCTG
CAGATAGCGGCCACGGAGCTGGAGAAGGAGGAGAGCCGCCGTGAGGCAGAGAAGCAGAACTACCTGGCG
GAGCACTGCCCGCCGCTGCATATCCCGGGCTCCATGTCTGAAGTGCAGGAGCTCTGCAAACAGCTGCAC
GCCAAGATCGATGCGGCTGAAGAGGAGAAGTACGACATGGAGGTGAGGGTGCAGAAGACCAGCAAGGAG
CTGGAGGACATGAACCAGAAGCTATTTGATCTGCGGGGCAAGTTCAAGCGGCCCCCACTGCGGAGGGTG
CGCATGTCGGCCGATGCCATGCTCAAGGCCCTGCTGGGCTCGAAGCACAAGGTGTGCATGGACCTGAGG
GCCAACCTGAAGCAGGTCAAGAAGGAGGACACAGAGAAGGAGCGGGACCTGCGAGACGTGGGTGACTGG
AGGAAGAACATCGAGGAGAAGTCTGGCATGGAGGGCCGGAAGAAGATGTTTGAGTCCGAGTCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145829
Insert Size 549 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145829.1
RefSeq Size 746 bp
RefSeq ORF 549 bp
Locus ID 7136
UniProt ID P48788
Cytogenetics 11p15.5
MW 21.3 kDa
Gene Summary This gene encodes a fast-twitch skeletal muscle protein, a member of the troponin I gene family, and a component of the troponin complex including troponin T, troponin C and troponin I subunits. The troponin complex, along with tropomyosin, is responsible for the calcium-dependent regulation of striated muscle contraction. Mouse studies show that this component is also present in vascular smooth muscle and may play a role in regulation of smooth muscle function. In addition to muscle tissues, this protein is found in corneal epithelium, cartilage where it is an inhibitor of angiogenesis to inhibit tumor growth and metastasis, and mammary gland where it functions as a co-activator of estrogen receptor-related receptor alpha. This protein also suppresses tumor growth in human ovarian carcinoma. Mutations in this gene cause myopathy and distal arthrogryposis type 2B. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
Transcript Variant: This variant (2) has an alternate 5' UTR exon, and encodes the same isoform 1, as compared to variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.