Apolipoprotein L 1 (APOL1) (NM_001136541) Human Untagged Clone

CAT#: SC325852

APOL1 (untagged)-Human apolipoprotein L, 1 (APOL1), transcript variant 4


  "NM_001136541" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
APOL1 mouse monoclonal antibody,clone OTI3D9
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Apolipoprotein L 1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Apolipoprotein L 1
Synonyms APO-L; APOL; APOL-I; FSGS4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325852 representing NM_001136541.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGGAGCTGCTTTGCTGAGAGTCTCTGTCCTCTGCATCTGGGTGCAACAAAACGTTCCAAGTGGG
ACAGATACTGGAGATCCTCAAAGTAAGCCCCTCGGTGACTGGGCTGCTGGCACCATGGACCCAGAGAGC
AGTATCTTTATTGAGGATGCCATTAAGTATTTCAAGGAAAAAGTGAGCACACAGAATCTGCTACTCCTG
CTGACTGATAATGAGGCCTGGAACGGATTCGTGGCTGCTGCTGAACTGCCCAGGAATGAGGCAGATGAG
CTCCGTAAAGCTCTGGACAACCTTGCAAGACAAATGATCATGAAAGACAAAAACTGGCACGATAAAGGC
CAGCAGTACAGAAACTGGTTTCTGAAAGAGTTTCCTCGGTTGAAAAGTGAGCTTGAGGATAACATAAGA
AGGCTCCGTGCCCTTGCAGATGGGGTTCAGAAGGTCCACAAAGGCACCACCATCGCCAATGTGGTGTCT
GGCTCTCTCAGCATTTCCTCTGGCATCCTGACCCTCGTCGGCATGGGTCTGGCACCCTTCACAGAGGGA
GGCAGCCTTGTACTCTTGGAACCTGGGATGGAGTTGGGAATCACAGCCGCTTTGACCGGGATTACCAGC
AGTACCATGGACTACGGAAAGAAGTGGTGGACACAAGCCCAAGCCCACGACCTGGTCATCAAAAGCCTT
GACAAATTGAAGGAGGTGAGGGAGTTTTTGGGTGAGAACATATCCAACTTTCTTTCCTTAGCTGGCAAT
ACTTACCAACTCACACGAGGCATTGGGAAGGACATCCGTGCCCTCAGACGAGCCAGAGCCAATCTTCAG
TCAGTACCGCATGCCTCAGCCTCACGCCCCCGGGTCACTGAGCCAATCTCAGCTGAAAGCGGTGAACAG
GTGGAGAGGGTTAATGAACCCAGCATCCTGGAAATGAGCAGAGGAGTCAAGCTCACGGATGTGGCCCCT
GTAAGCTTCTTTCTTGTGCTGGATGTAGTCTACCTCGTGTACGAATCAAAGCACTTACATGAGGGGGCA
AAGTCAGAGACAGCTGAGGAGCTGAAGAAGGTGGCTCAGGAGCTGGAGGAGAAGCTAAACATTCTCAAC
AATAATTATAAGATTCTGCAGGCGGACCAAGAACTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001136541
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136541.1
RefSeq Size 2831 bp
RefSeq ORF 1143 bp
Locus ID 8542
UniProt ID O14791
Cytogenetics 22q12.3
Protein Families Secreted Protein, Transmembrane
MW 42.2 kDa
Gene Summary This gene encodes a secreted high density lipoprotein which binds to apolipoprotein A-I. Apolipoprotein A-I is a relatively abundant plasma protein and is the major apoprotein of HDL. It is involved in the formation of most cholesteryl esters in plasma and also promotes efflux of cholesterol from cells. This apolipoprotein L family member may play a role in lipid exchange and transport throughout the body, as well as in reverse cholesterol transport from peripheral cells to the liver. Several different transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (4) lacks an alternate in-frame 5' coding segment, compared to variant 1. The resulting protein (isoform c) has a shorter N-terminus when it is compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.