RABL2B (NM_001130923) Human Untagged Clone

CAT#: SC325647

RABL2B (untagged)-Human RAB, member of RAS oncogene family-like 2B (RABL2B), transcript variant 7


  "NM_001130923" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


RABL2B rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "RABL2B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RABL2B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325647 representing NM_001130923.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGAAGACAAAACCAAACCGAGTGAGTTGGACCAAGGGAAGTATGATGCTGATGACAACGTGAAG
ATCATCTGCCTGGGAGACAGCGCAGTGGGCAAATCCAAACTCATGGAGAGATTTCTCATGGATGGCTTT
CAGCCACAGCAGCTGTCCACGTACGCCCTGACCCTGTACAAGCACACAGCCACGGTAGATGGAAGGACC
ATCCTTGTGGACTTTTGGGACACGGCAGGCCAGGAGCGGTTCCAGAGCATGCATGCCTCCTACTACCAC
AAGGCCCACGCCTGCATCATGGTGTTTGATGTACAGAGGAAAGTCACCTATAGGAACCTGAGCACCTGG
TATACAGAGCTTCGGGAGTTCAGGCCAGAGATCCCATGCATCGTGGTGGCCAATAAAATTGATGACATA
AACGTGACCCAAAAAAGCTTCAATTTTGCCAAGAAGTTCTCCCTGCCCCTGTATTTCGTCTCGGCTGCT
GATGGTACCAATGTTGTGAAGGTGTGGTTGACTGCAGAGGTAGCTAGCAAGCTCTTCAATGATGCAATT
CGATTAGCTGTGTCTTACAAACAGAACTCCCAGGACTTCATGGATGAGATTTTTCAGGAGCTCGAGAAC
TTCAGCTTGGAGCAGGAAGAGGAGGACGTGCCAGACCAGGAACAGAGCAGCAGCATCGAGACCCCATCA
GAGGAGGCGGCCTCTCCCCACAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130923
Insert Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130923.1
RefSeq Size 2372 bp
RefSeq ORF 717 bp
Locus ID 11158
UniProt ID Q9UNT1
Cytogenetics 22q13.33
Protein Families Druggable Genome
MW 27.2 kDa
Gene Summary The RABL2B protein is a member of the RAB gene family which belongs to the RAS GTPase superfamily. RABL2B is located within a subtelomeric region of 22q13.3. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (7) encodes isoform 3. Variants 7, 18, 19 and 20 all encode the same isoform (3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.