RIZ1 (PRDM2) (NM_001135610) Human Untagged Clone

CAT#: SC325626

PRDM2 (untagged)-Human PR domain containing 2, with ZNF domain (PRDM2), transcript variant 4


  "NM_001135610" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-PRDM2 Antibody
    • 100 ul

USD 380.00

Other products for "RIZ1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RIZ1
Synonyms HUMHOXY1; KMT8; KMT8A; MTB-ZF; RIZ; RIZ1; RIZ2
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001135610 edited
ATGAATCAGAACACTACTGAGCCTGTGGCGGCCACCGAGACCCTGGCTGAGGTACCCGAA
CATGTGCTGCGAGGACTTCCGGAGGAAGTGAGGCTTTTCCCTTCTGCTGTTGACAAGACC
CGGATTGGTGTCTGGGCCACTAAACCAATTTTAAAAGGCAAAAAATTTGGGCCATTTGTT
GGTGATAAGAAAAAAAGATCTCAGGTTAAGAATAATGTATACATGTGGGAGGTGTATTAC
CCAAATTTGGGATGGATGTGCATTGATGCCACTGATCCAGAGAAGGGAAACTGGCTGCGA
TATGTGAATTGGGCTTGCTCAGGAGAAGAGCAAAATTTATTCCCACTGGAAATCAACAGA
GCCATTTACTATAAAACTTTAAAGCCAATCGCGCCGGGCGAGGAGCTCCTGGTCTGGTAC
AATGGGGAAGACAACCCTGAGATAGCAGCTGCGATTGAGGAAGAGCGAGCCAGCGCCCGG
AGCAAGCGGAGCTCCCCCAAGAGCCGGAAAGCTACAGCCTCCGCTTGGCGTCCCGATGCT
CTCCACCAGCGGCCCCGTACATCACCAGGCAGTATAGGAAGGTCAAAGCTCCAGCTGCAG
CCCAGTTCCAGGGACCATTCTTCAAAGAGTAGACACTCTGGCTGCTCCCTGACAGCACCT
GAAGTGACCTGGAATCAGTGA
Restriction Sites Please inquire     
ACCN NM_001135610
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001135610.1, NP_001129082.1
RefSeq Size 2715 bp
RefSeq ORF 681 bp
Locus ID 7799
UniProt ID Q13029
Cytogenetics 1p36.21
Protein Families Druggable Genome
Gene Summary This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (4) has an alternate 5' UTR and lacks two internal coding exons compared to variant 1. The resulting isoform (d) is much shorter and has a distinct C-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.