CHAC1 (NM_001142776) Human Untagged Clone

CAT#: SC325621

CHAC1 (untagged)-Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHAC1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC325621 representing NM_001142776.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGGGGCGCTCAGCTGGAGCTACCGAGCGGTGCCAGGCCAGGTGTGTGCGTCCGTCGGTCTTTCCGT
  GCCCACGCCGGAGACCAGCCCCGGAGGCCGCCTGGGCCTATCCCTGTGCCAGGCACCATGAAGCAGGAG
  TCTGCAGCCCCGAACACCCCGCCCACCTCGCAGTCCCCTACGCCGTCCGCTCAGTTCCCCCGAAACGAC
  GGCGACCCTCAAGCGCTGTGGATTTTCGGGTACGGCTCCCTGGTGTGGAGGCCCGACTTCGCCTACAGC
  GACAGCCGTGTGGGCTTCGTGCGCGGCTACAGCCGCCGTTTCTGGCAGGGAGACACCTTCCATCGGGGC
  AGCGACAAGATGCCTGGCCGTGTGGTGACGCTCCTTGAAGATCATGAGGGCTGCACTTGGGGCGTGGCA
  TACCAAGTGCAAGGGGAGCAGAACCCTGGTTACCTGGGCCCTGCGCCTGAAGAGGCCATTGCCACGCAG
  ATCCTGGCCTGCCGGGGCTTCTCCGGCCACAACCTTGAATACTTGCTGCGTCTGGCAGACTTCATGCAG
  CTCTGTGGGCCTCAGGCGCAGGACGAGCACCTGGCAGCCATCGTGGACGCTGTGGGCACCATGTTGCCC
  TGCTTCTGCCCCACCGAGCAGGCTCTGGCGCTGGTGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142776
• Insert Size: 660 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001142776.1
• RefSeq Size: 1443 bp
• RefSeq ORF: 660 bp
• Locus ID: 79094
• Cytogenetics: 15q15.1
• MW: 23.8 kDa
• Gene Summary: This gene encodes a member of the gamma-glutamylcyclotransferase family of proteins. The encoded protein has been shown to promote neuronal differentiation by deglycination of the Notch receptor, which prevents receptor maturation and inhibits Notch signaling. This protein may also play a role in the unfolded protein response, and in regulation of glutathione levels and oxidative balance in the cell. Elevated expression of this gene may indicate increased risk of cancer recurrence among breast and ovarian cancer patients. [provided by RefSeq, Sep 2016]
  Transcript Variant: This variant (2) lacks an alternate in-frame segment, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a. CCDS Note: The coding region has been updated to trim the N-terminus to one that is more supported by available transcript data, CAGE data and conservation data.