SYT2 (NM_001136504) Human Untagged Clone

CAT#: SC325075

SYT2 (untagged)-Human synaptotagmin II (SYT2), transcript variant 2


  "NM_001136504" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-SYT2 Antibody
    • 100 ul

USD 539.00

Other products for "SYT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SYT2
Synonyms CMS7; MYSPC; SytII
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001136504, the custom clone sequence may differ by one or more nucleotides
ATGAGGAACATTTTCAAGAGGAACCAGGAGCCTATTGTGGCTCCTGCCACCACCACCGCC
ACGATGCCCATTGGACCCGTGGACAACTCCACTGAGAGTGGGGGTGCTGGGGAGAGCCAG
GAGGACATGTTTGCCAAACTGAAGGAGAAGTTATTCAATGAGATAAACAAGATTCCCTTA
CCACCCTGGGCACTGATCGCCATTGCTGTGGTTGCTGGGCTCCTGCTTCTCACCTGCTGC
TTCTGCATCTGCAAGAAATGCTGCTGCAAGAAGAAGAAGAACAAGAAGGAGAAGGGCAAA
GGCATGAAGAATGCCATGAACATGAAGGACATGAAAGGGGGTCAGGATGACGACGACGCA
GAGACAGGCCTGACTGAGGGGGAAGGTGAAGGGGAGGAGGAGAAAGAGCCAGAGAACCTG
GGCAAACTGCAGTTTTCCCTGGACTATGATTTTCAGGCTAATCAGCTTACTGTGGGCGTT
CTGCAGGCTGCTGAACTGCCTGCCCTGGACATGGGAGGCACCTCAGACCCTTATGTCAAG
GTCTTCCTCCTTCCTGACAAGAAGAAGAAATATGAGACCAAAGTCCATCGGAAGACACTG
AACCCTGCCTTCAATGAAACCTTCACCTTCAAGGTGCCATACCAGGAGCTTGGGGGCAAA
ACTCTGGTGATGGCCATCTATGACTTTGACCGCTTCTCCAAACATGACATCATTGGAGAG
GTAAAGGTGCCTATGAACACAGTGGACCTCGGCCAGCCCATTGAGGAGTGGAGAGACCTG
CAAGGCGGGGAAAAGGAGGAGCCGGAGAAGCTGGGCGACATCTGCACCTCCCTGCGCTAT
GTGCCCACGGCCGGGAAGCTCACTGTCTGCATCCTGGAGGCTAAGAACCTCAAGAAGATG
GACGTGGGCGGCCTTTCAGACCCGTACGTGAAGATCCACCTGATGCAGAATGGCAAGAGG
CTCAAGAAGAAGAAGACAACCGTGAAGAAGAAGACCCTGAACCCATACTTCAACGAGTCC
TTCAGCTTTGAGATCCCCTTCGAGCAGATTCAGAAAGTCCAGGTAGTGGTCACCGTGCTG
GACTATGACAAGCTGGGCAAGAACGAAGCCATAGGCAAGATCTTCGTGGGCAGCAATGCC
ACGGGCACAGAGCTGCGGCACTGGTCCGACATGCTGGCCAACCCCCGGAGGCCCATCGCC
CAGTGGCACTCGCTCAAGCCTGAGGAGGAGGTGGATGCACTCCTGGGCAAGAACAAG
Restriction Sites Please inquire     
ACCN NM_001136504
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136504.1, NP_001129976.1
RefSeq Size 7614 bp
RefSeq ORF 1260 bp
Locus ID 127833
UniProt ID Q8N9I0
Cytogenetics 1q32.1
Protein Families Secreted Protein, Transmembrane
Gene Summary This gene encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in this gene are associated with myasthenic syndrome, presynaptic, congenital, with or without motor neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.