DCTN4 (NM_001135644) Human Untagged Clone

CAT#: SC325054

DCTN4 (untagged)-Human dynactin 4 (p62) (DCTN4), transcript variant 3


  "NM_001135644" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-DCTN4 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "DCTN4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DCTN4
Synonyms DYN4; P62
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001135644, the custom clone sequence may differ by one or more nucleotides
ATGCCATCGGCTGAAGCCAAACTAAAAAAGAATAGATGTGCCAATTGTTTTGACTGTCCT
GGCTGCATGCACACCCTCTCTACTCGGGCCACGAGCATCTCCACACAGCTTCCAGATGAC
CCAGCCAAGACCACCATGAAGAAAGCCTATTACCTGGCATGTGGATTTTGTCGCTGGACG
TCTAGAGATGTGGGCATGGCAGACAAATCTGTAGCTAGTGGCGGTTGGCAGGAACCTGAA
AATCCTCACACACAACGGATGAACAAATTGATTGAATATTACCAGCAGCTTGCTCAGAAA
GAGAAGGTTGAGCGAGATCGCAAGAAACTGGCACGACGTAGAAACTATATGCCTCTGGCT
TTTTCGGACAAATATGGTCTTGGAACCAGGCTTCAGCGACCACGAGCTGGTGCATCCATC
AGTACCCTTGCCGGACTTTCCCTTAAAGAAGGAGAGGATCAGAAAGAGATAAAGATTGAG
CCAGCTCAGGCTGTGGATGAAGTGGAACCTCTACCTGAAGACTATTATACAAGACCAGTA
AATTTAACAGAGGTAACAACCCTTCAGCAGCGTCTGTTACAGCCTGACTTCCAGCCAGTC
TGTGCTTCACAGCTCTATCCTCGCCACAAACATCTTCTGATCAAACGGTCCCTGCGCTGC
CGTAAATGTGAACATAATTTGAGCAAGCCAGAATTTAACCCAACGTCAATCAAATTCAAA
ATCCAGCTGGTCGCTGTCAATTATATTCCAGAAGTGAGAATCATGTCAATTCCCAACCTT
CGCTACATGAAGGAGAGCCAGGTCCTCCTGACTCTTACAAATCCAGTTGAGAACCTCACC
CATGTGACTCTCTTCGAGTGTGAGGAGGGGGACCCTGATGATATCAACAGCACTGCTAAG
GTGGTGGTGCCTCCCAAAGAGCTCGTTTTAGCTGGCAAGGATGCAGCAGCAGAGTACGAT
GAGTTGGCAGAACCTCAAGACTTTCAGGACGATCCTGACATTATAGCCTTCAGAAAGGCC
AACAAAGTGGGTATTTTCATCAAAGTTACACCACAGCGTGAGGAGGGTGAAGTGACCGTG
TGCTTCAAGATGAAGCATGATTTTAAAAACCTGGCAGCCCCCATTCGCCCCATTGAAGAA
AGTGACCAGGGAACAGAAGTCATCTGGCTCACCCAGCATGTGGAACTTAGCTTGGGCCCA
CTTCTTCCT
Restriction Sites Please inquire     
ACCN NM_001135644
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001135644.1, NP_001129116.1
RefSeq Size 4105 bp
RefSeq ORF 1212 bp
Locus ID 51164
UniProt ID Q9UJW0
Cytogenetics 5q33.1
Protein Pathways Huntington's disease
Gene Summary Could have a dual role in dynein targeting and in ACTR1A/Arp1 subunit of dynactin pointed-end capping. Could be involved in ACTR1A pointed-end binding and in additional roles in linking dynein and dynactin to the cortical cytoskeleton.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (c) is shorter at the N-terminus and lacks a 7 aa internal segment compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.