HSPBP1 (NM_001130106) Human Untagged Clone

CAT#: SC324992

HSPBP1 (untagged)-Human HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 (HSPBP1), transcript variant 2


  "NM_001130106" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
HSPBP1 mouse monoclonal antibody, clone OTI1D5 (formerly 1D5)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "HSPBP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HSPBP1
Synonyms FES1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324992 representing NM_001130106.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCAGACGAAGGCTCAAGGGGGAGCCGCCTGCCCCTGGCGCTGCCCCCGGCCTCCCAGGGTTGCTCT
TCAGGGGGCGGCGGCGGCGGCTCCTCGGCTGGGGGCTCGGGCAATTCCCGGCCCCCACGCAACCTCCAA
GGCTTGCTGCAGATGGCCATCACCGCGGGCTCTGAAGAGCCAGACCCTCCTCCAGAACCGATGAGTGAG
GAGAGGCGTCAGTGGCTGCAGGAGGCCATGTCGGCTGCCTTCCGAGGCCAGCGGGAGGAGGTGGAGCAG
ATGAAGAGCTGCCTCCGAGTGCTGTCACAGCCCATGCCCCCCACTGCTGGGGAGGCCGAGCAGGCGGCC
GACCAGCAAGAGCGAGAGGGGGCCCTGGAGCTGCTGGCCGACCTGTGTGAGAACATGGACAATGCCGCA
GACTTCTGCCAGCTGTCTGGCATGCACCTGCTGGTGGGCCGGTACCTGGAGGCGGGGGCTGCGGGACTG
CGGTGGCGGGCGGCACAGCTCATCGGCACGTGCAGTCAGAACGTGGCAGCCATCCAGGAGCAGGTGCTG
GGCCTGGGTGCCCTGCGTAAGCTGCTGCGGCTGCTGGACCGCGACGCCTGCGACACGGTGCGCGTCAAG
GCCCTCTTCGCCATCTCCTGTCTGGTCCGAGAGCAGGAGGCTGGGCTGCTGCAGTTCCTCCGCCTGGAC
GGCTTCTCTGTGTTGATGAGGGCCATGCAGCAGCAGGTGCAGAAGCTCAAGGTCAAATCAGCATTCCTG
CTGCAGAACCTGCTGGTGGGCCACCCTGAACACAAAGGGACCCTGTGCTCCATGGGGATGGTCCAGCAG
CTGGTGGCCCTGGTGCGGACAGAGCACAGCCCCTTCCACGAGCACGTGCTTGGAGCCCTGTGCAGCCTG
GTGACAGACTTTCCGCAGGGTGTGCGCGAGTGTCGGGAGCCGGAACTGGGCCTGGAGGAGCTCCTCCGC
CACCGCTGTCAGCTGCTGCAGCAGCATGAGGAGTACCAGGAGGAGCTGGAGTTCTGTGAAAAGCTGCTA
CAGACCTGTTTCTCCAGCCCAGCGGACGACAGCATGGATCGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130106
Insert Size 1080 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130106.1
RefSeq Size 1816 bp
RefSeq ORF 1080 bp
Locus ID 23640
UniProt ID Q9NZL4
Cytogenetics 19q13.42
MW 39.3 kDa
Gene Summary Inhibits HSPA1A chaperone activity by changing the conformation of the ATP-binding domain of HSPA1A and interfering with ATP binding. Interferes with ubiquitination mediated by STUB1 and inhibits chaperone-assisted degradation of immature CFTR.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 3. Variants 1 and 2 encode the same isoform (2), which has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.