RPL6 (NM_001024662) Human Untagged Clone

CAT#: SC324614

RPL6 (untagged)-Human ribosomal protein L6 (RPL6), transcript variant 1


  "NM_001024662" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-RPL6 Antibody
    • 100 ul

USD 485.00

Other products for "RPL6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPL6
Synonyms L6; SHUJUN-2; TAXREB107; TXREB1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001024662.1 ATCTTGCAAGGTAAGAATCGCGGGCCTGTCTGCAAGACTTGAGTTCAGGACTCCCAATCC
TTCGCCATCCGAACCTGGAGGGCATCCAGTCGACACCTACAGGGGTCGGACATGTCCAAG
GCTAACTGAGAGGCCTTCCAGACGCTTCATTTTTGTTGTTTGGGTTTGCGGCAGGGCACA
AAGAGGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGAAGAGACCCGAAGCC
AAGAAGGTTGATGCTGGTGGCAAGGTGAAAAAGGGTAACCTCAAAGCTAAAAAGCCCAAG
AAGGGGAAGCCCCATTGCAGCCGCAACCCTGTCCTTGTCAGAGGAGTTGGCAGGTATTCC
CGATCTGCCATGTATTCCAGAAAGGCCATGTACAAGAGGAAGTACTCAGCCGCTAAATCC
AAGGTTGAAAAGAAAAAGAAGGAGAAGGTTCTCGCAACTGTTACAAAACCAGTTGGTGGT
GACAAGAACGGCGGTACCCGGGTGGTTAAACTTCGCAAAATGCCTAGATATTATCCTACT
GAAGATGTGCCTCGAAAGCTGTTGAGCCACGGCAAAAAACCCTTCAGTCAGCACGTGAGA
AAACTGCGAGCCAGCATTACCCCCGGGACCATTCTGATCATCCTCACTGGACGCCACAGG
GGCAAGAGGGTGGTTTTCCTGAAGCAGCTGGCTAGTGGCTTATTACTTGTGACTGGACCT
CTGGTCCTCAATCGAGTTCCTCTACGAAGAACACACCAGAAATTTGTCATTGCCACTTCA
ACCAAAATCGATATCAGCAATGTAAAAATCCCAAAACATCTTACTGATGCTTACTTCAAG
AAGAAGAAGCTGCGGAAGCCCAGACACCAGGAAGGTGAGATCTTCGACACAGAAAAAGAG
AAATATGAGATTACGGAGCAGCGCAAGATTGATCAGAAAGCTGTGGACTCACAAATTTTA
CCAAAAATCAAAGCTATTCCTCAGCTCCAGGGCTACCTGCGATCTGTGTTTGCTCTGACG
AATGGAATTTATCCTCACAAATTGGTGTTCTAAATGTCTTAAGAACCTAATTAAATAGCT
GACTACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001024662
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001024662.1, NP_001019833.1
RefSeq Size 1148 bp
RefSeq ORF 867 bp
Locus ID 6128
UniProt ID Q02878
Cytogenetics 12q24.13
Protein Families Transcription Factors
Protein Pathways Ribosome
Gene Summary This gene encodes a protein component of the 60S ribosomal subunit. This protein can bind specifically to domain C of the tax-responsive enhancer element of human T-cell leukemia virus type 1, and may participate in tax-mediated transactivation of transcription. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, 5, 6, and 7 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.