CMTM7 (NM_138410) Human Untagged Clone
CAT#: SC324605
CMTM7 (untagged)-Human CKLF-like MARVEL transmembrane domain containing 7 (CMTM7), transcript variant 1
"NM_138410" in other vectors (5)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CMTM7 |
Synonyms | CKLFSF7 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_138410.2
GGCACGAGGGCGAGCTGGGGCCGCGCAATGTCGCACGGAGCCGGGCTCGTCCGCACCACG
TGCAGCAGCGGCAGCGCGCTCGGACCCGGGGCCGGCGCGGCCCAGCCCAGCGCGAGCCCC TTGGAGGGGCTGCTGGACCTCAGCTACCCCCGCACCCACGCGGCCCTGCTGAAAGTGGCG CAAATGGTCACCCTGCTGATTGCCTTCATCTGTGTGCGGAGCTCCCTGTGGACCAACTAC AGCGCCTACAGCTACTTTGAAGTGGTCACCATTTGCGACTTGATAATGATCCTCGCCTTT TACCTGGTCCACCTCTTCCGCTTCTACCGCGTGCTCACCTGTATCAGCTGGCCCCTGTCG GAACTTCTGCACTATTTAATCGGTACCCTGCTCCTCCTCATCGCCTCCATTGTGGCAGCT TCCAAGAGTTACAACCAGAGCGGACTGGTAGCCGGAGCGATCTTTGGTTTCATGGCCACC TTCCTCTGCATGGCAAGCATATGGCTGTCCTATAAGATCTCGTGTGTAACCCAGTCCACA GATGCAGCCGTCTGATGAGGCCACAACCCCTAGGCCCCTCAGGAGCTTTGCAGAGAGGAG GACGTGTACTCCAGGCGAGGCCTCTGGACCTGTGTTCCTGTGCCAAAGTCCTGTCAGGCT GGTGGGCACCAGGAAAGGCCTGCACCCTCTTCCTGCTCTCCCAGGAAGCCAGCTCCCTGA GCTCCTGAGCCAGCCGGAAACTCTTCCTCCAGCCTTCCGGGGAGAACATCCCTCCCATTC TGGGAAAGGAAAGCAGCCTCCAGGGAAATGTTTTCTGCCTTCCTGCTTCTAGAACCACCT CAGGTACTGATGAACCCCACTTAGCACAGCTGAAGGGGTTTGTGAATACTCCCGCCTAAA TCCCTTCTACTTCACTCCTCAGGGGAGTGAAGTGCCTTAAGAAACAAAGCCCTGTCCTAA TTTATCTAGCTTGTCAGTCCGGTCTTAGAGATACCCTCTTTCCTGAAGTGAGGCGTGCCT GTAGAAACACTATGTGGTCAGCCTGTCCCCAAGGAGATCTTGTGTCTCCTCTCCATCTCT GCCTTTGTTACCAGTGTGCATGTGTTTGTGTGTTTTTTTAATAAAATATTGACTCGGCCA GTTAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_138410 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_138410.2, NP_612419.1 |
RefSeq Size | 1369 bp |
RefSeq ORF | 528 bp |
Locus ID | 112616 |
UniProt ID | Q96FZ5 |
Cytogenetics | 3p22.3 |
Protein Families | Transmembrane |
Gene Summary | This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. This gene acts as a tumor suppressor that regulates G1/S transition in the cell cycle, and epidermal growth factor receptor/protein kinase B signaling during tumor pathogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204059 | CMTM7 (Myc-DDK-tagged)-Human CKLF-like MARVEL transmembrane domain containing 7 (CMTM7), transcript variant 1 |
USD 300.00 |
|
RC204059L3 | Lenti ORF clone of Human CKLF-like MARVEL transmembrane domain containing 7 (CMTM7), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
RC204059L4 | Lenti ORF clone of Human CKLF-like MARVEL transmembrane domain containing 7 (CMTM7), transcript variant 1, mGFP tagged |
USD 600.00 |
|
RG204059 | CMTM7 (tGFP-tagged) - Human CKLF-like MARVEL transmembrane domain containing 7 (CMTM7), transcript variant 1 |
USD 500.00 |
|
SC120447 | CMTM7 (untagged)-Human CKLF-like MARVEL transmembrane domain containing 7 (CMTM7), transcript variant 1 |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review