Dystrobrevin alpha (DTNA) (NM_001128175) Human Untagged Clone
CAT#: SC323009
DTNA (untagged)-Human dystrobrevin, alpha (DTNA), transcript variant 9
"NM_001128175" in other vectors (4)
Product Images
USD 447.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DTNA |
Synonyms | D18S892E; DRP3; DTN; DTN-A; LVNC1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001128175, the custom clone sequence may differ by one or more nucleotides
ATGATTGAAGATAGTGGGAAAAGAGGAAATACCATGGCAGAAAGAAGACAGCTGTTTGCA GAGATGAGGGCTCAAGATCTGGATCGCATCCGACTCTCCACCTACAGAACAGCATGCAAG CTTAGGTTTGTTCAGAAGAAATGCAATTTGCACCTGGTGGACATATGGAATGTCATAGAA GCATTGCGGGAAAATGCTCTGAACAACCTGGACCCAAACACTGAACTCAACGTGTCCCGC TTAGAGGCTGTGCTCTCCACTATTTTTTACCAGCTCAACAAACGGATGCCAACCACTCAC CAAATCCATGTGGAGCAGTCCATCAGCCTCCTCCTTAACTTCCTGCTTGCAGCGTTTGAT CCGGAAGGCCATGGTAAAATTTCAGTATTTGCTGTCAAAATGGCTTTAGCCACATTGTGT GGAGGGAAGATCATGGACAAATTAAGATATATTTTCTCAATGATTTCTGACTCCAGTGGG GTGATGGTTTATGGACGATATGACCAATTCCTTCGGGAAGTTCTCAAACTACCCACGGCA GTTTTTGAAGGTCCTTCATTTGGTTACACAGAACAGTCAGCCAGATCCTGTTTCTCCCAA CAGAAAAAAGTCACGTTAAATGGTTTCTTGGACACGCTTATGTCAGATCCTCCCCCGCAG TGTCTGGTCTGGTTGCCTCTTCTGCATCGACTAGCAAATGTGGAAAATGTCTTCCATCCG GTTGAGTGTTCCTACTGCCACAGTGAGAGTATGATGGGATTTCGCTACCGATGCCAACAG TGTCACAATTACCAGCTCTGTCAGGACTGCTTCTGGAGGGGACATGCCGGTGGTTCTCAT AGCAACCAGCACCAAATGAAAGAGTACACGTCATGGAAATCACCTGCTAAGAAGCTGACT AATGCATTAAGCAAGTCCCTGAGCTGTGCTTCCAGCCGTGAACCTTTGCACCCCATGTTC CCAGATCAGCCTGAGAAGCCACTCAACTTGGCTCACATCGTGCCTCCCAGACCTGTAACC AGCATGAACGACACCCTGTTCTCCCACTCTGTTCCCTCCTCAGGAAGTCCTTTTATTACC AGGAGCTCGGACGGTGCTTTTGGTGGATGCGTC |
Restriction Sites | Please inquire |
ACCN | NM_001128175 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001128175.1, NP_001121647.1 |
RefSeq Size | 1728 bp |
RefSeq ORF | 1116 bp |
Locus ID | 1837 |
UniProt ID | Q9Y4J8 |
Cytogenetics | 18q12.1 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (9) lacks an internal coding exon and multiple exons from the 3' end, and contains an alternate 3' exon, compared to variant 1. The resulting isoform (9) lacks an internal segment and has a much shorter and distinct C-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225568 | DTNA (Myc-DDK-tagged)-Human dystrobrevin, alpha (DTNA), transcript variant 9 |
USD 503.00 |
|
RC225568L3 | Lenti-ORF clone of DTNA (Myc-DDK-tagged)-Human dystrobrevin, alpha (DTNA), transcript variant 9 |
USD 803.00 |
|
RC225568L4 | Lenti-ORF clone of DTNA (mGFP-tagged)-Human dystrobrevin, alpha (DTNA), transcript variant 9 |
USD 803.00 |
|
RG225568 | DTNA (tGFP-tagged) - Human dystrobrevin, alpha (DTNA), transcript variant 9 |
USD 703.00 |
{0} Product Review(s)
Be the first one to submit a review