PSG5 (NM_001130014) Human Untagged Clone

CAT#: SC322984

PSG5 (untagged)-Human pregnancy specific beta-1-glycoprotein 5 (PSG5), transcript variant 2


  "NM_001130014" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-PSG5 Antibody
    • 100 ul

USD 485.00

Other products for "PSG5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PSG5
Synonyms FL-NCA-3; PSG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322984 representing NM_001130014.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGCCCCTCTCAGCCCCTCCCTGCACACAGCACATCACCTGGAAGGGGGTCCTGCTCACAGCATCA
CTTTTAAACTTCTGGAACCTGCCTATCACTGCTCAAGTCACGATTGAAGCCCTGCCACCCAAAGTTTCC
GAGGGGAAGGATGTTCTTCTACTTGTCCACAATTTGCCTCAGAATCTTGCTGGCTACATCTGGTACAAA
GGACAACTGATGGACCTCTACCATTACATTACATCATATGTAGTAGACGGTCAAATAAATATATATGGG
CCTGCATACACTGGACGAGAAACAGTATATTCCAATGCATCCCTGCTGATCCAGAATGTCACCCGGGAA
GACGCAGGATCCTATACCTTACACATCATAAAGCGAGGTGATAGGACTAGAGGAGTAACTGGATATTTC
ACCTTCAACTTATACCTGAAGCTGCCCAAGCCCTACATCACCATCAACAACTCAAAACCCAGGGAGAAT
AAGGATGTCTTAGCCTTCACCTGTGAACCTAAGAGTGAGAACTACACCTACATTTGGTGGCTAAATGGT
CAGAGCCTCCCGGTCAGTCCCAGGGTAAAGCAACCCATTGAAAACAGGATCCTCATTCTACCCAGTGTC
ACGAGAAATGAAACAGGACCCTATGAATGTGAAATACGGGACCGAGATGGTGGCATGCACAGTGACCCA
GTCACCCTGAATGTCCTCTATGGTCCAGACCTCCCCAGCATTTACCCTTCATTCACCTATTACCGTTCA
GGAGAAAACCTCTACTTGTCCTGCTTCGCGGAATCTAACCCACCGGCAGAGTATTTTTGGACAATTAAT
GGGAAGTTTCAGCAATCAGGACAAAAGCTCTCTATCCCCCAAATTACTACAAAGCATAGAGGGCTCTAT
ACTTGCTCTGTTCGTAACTCAGCCACTGGCAAGGAAAGCTCCAAATCCATGACAGTCGAAGTCTCTGCT
CCTTCAGGAATAGGACGTCTTCCTCTCCTTAATCCAATATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130014
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130014.1
RefSeq Size 1601 bp
RefSeq ORF 1008 bp
Locus ID 5673
UniProt ID Q15238
Cytogenetics 19q13.31
Protein Families Secreted Protein
MW 37.7 kDa
Gene Summary The human pregnancy-specific glycoproteins (PSGs) are a group of molecules that are mainly produced by the placental syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of the carcinoembryonic antigen (CEA) family, which belongs to the immunoglobulin superfamily. For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]
Transcript Variant: This variant (2) lacks a segment in the 3' exon, as compared to variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.