IL11 (NM_000641) Human Untagged Clone

CAT#: SC322493

IL11 (untagged)-Human interleukin 11 (IL11)


  "NM_000641" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-IL-11 Antibody
    • 100 ug

USD 570.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "IL11"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IL11
Synonyms AGIF; IL-11
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322493 GCTCAGGGCACATGCCTCCCCTCCCCAGGCCGCGGCCCAGCTGACCCTCGGGGCTCCCCC
GGCAGCGGACAGGGAAGGGTTAAAGGCCCCCGGCTCCCTGCCCCCTGCCCTGGGGAACCC
CTGGCCCTGTGGGGACATGAACTGTGTTTGCCGCCTGGTCCTGGTCGTGCTGAGCCTGTG
GCCAGATACAGCTGTCGCCCCTGGGCCACCACCTGGCCCCCCTCGAGTTTCCCCAGACCC
TCGGGCCGAGCTGGACAGCACCGTGCTCCTGACCCGCTCTCTCCTGGCGGACACGCGGCA
GCTGGCTGCACAGCTGAGGGACAAATTCCCAGCTGACGGGGACCACAACCTGGATTCCCT
GCCCACCCTGGCCATGAGTGCGGGGGCACTGGGAGCTCTACAGCTCCCAGGTGTGCTGAC
AAGGCTGCGAGCGGACCTACTGTCCTACCTGCGGCACGTGCAGTGGCTGCGCCGGGCAGG
TGGCTCTTCCCTGAAGACCCTGGAGCCCGAGCTGGGCACCCTGCAGGCCCGACTGGACCG
GCTGCTGCGCCGGCTGCAGCTCCTGATGTCCCGCCTGGCCCTGCCCCAGCCACCCCCGGA
CCCGCCGGCGCCCCCGCTGGCGCCCCCCTCCTCAGCCTGGGGGGGCATCAGGGCCGCCCT
CGCCATCCTGGGGGGGCTGCACCTGACACTTGACTGGGCCGTGAGGGGACTGCTGCTGCT
GAAGACTCGGCTGTGACCCGGGGCCCAAAGCCACCACCGTCCTTCCAAAGCCAGATCTTA
TTTATTTATTTATTTCAGTACTGGGGGCGAAACAGCCAGGTGATCCCCCCGCCATTATCT
CCCCCTAGTTAGAGACAGTCCTTCCGTGAGGCCTGGGGGACATCTGTGCCTTATTTATAC
TTATTTATTTCAGGAGCAGGGGTGGGAGGCAGGTGGACTCCTGGGTCCCCGAGGAGGAGG
GGACTGGGGTCCCGGATTCTTGGGTCTCCAAGAAGTCTGTCCACAGACTTCTGCCCTGGC
TCTTCCCCATCTAGGCCTGGGCAGGAACATATATTATTTATTTAAGCAATTACTTTTCAT
GTTGGGGTGGGGACGGAGGGGAAAGGGAAGCCTGGGTTTTTGTACAAAAATGTGAGAAAC
CTTTGTGAGACAGAGAACAGGGAATTAAATGTGTCATACATATCCAAAAAAAAAAAAAAA
A
Restriction Sites Please inquire     
ACCN NM_000641
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_000641.2, NP_000632.1
RefSeq Size 2354 bp
RefSeq ORF 600 bp
Locus ID 3589
UniProt ID P20809
Cytogenetics 19q13.42
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway
Gene Summary The protein encoded by this gene is a member of the gp130 family of cytokines. These cytokines drive the assembly of multisubunit receptor complexes, all of which contain at least one molecule of the transmembrane signaling receptor IL6ST (gp130). This cytokine is shown to stimulate the T-cell-dependent development of immunoglobulin-producing B cells. It is also found to support the proliferation of hematopoietic stem cells and megakaryocyte progenitor cells. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (1) is the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.