BEX2 (NM_032621) Human Untagged Clone
CAT#: SC322445
BEX2 (untagged)-Human brain expressed X-linked 2 (BEX2), transcript variant 3
"NM_032621" in other vectors (5)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BEX2 |
Synonyms | BEX1; DJ79P11.1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322445
CCCGGTGTCCCTGAGGACGTGCGGGCCAGGTACGGCCCCGAAAGTAGGAAGCGGAGGGGG
AGCAGGTTTGCGGGGCCAAGTGTTGCGGCGACGCACCTCACGTCGAGAATCGGGAGGAGG AGACTGCAAGGATAGGCCCAGGAGTAATGGAGTCCAAAGAGGAACGAGCGTTAAACAATC TCATCGTGGAAAATGTCAACCAGGAAAATGATGAAAAAGATGAAAAGGAGCAAGTTGCTA ATAAAGGGGAGCCCTTGGCCCTACCTTTGAATGTTAGTGAATACTGTGTGCCTAGAGGAA ACCGTAGGCGGTTCCGCGTTAGGCAGCCCATCCTGCAGTATAGATGGGACATAATGCATA GGCTTGGAGAGCCACAGGCAAGGATGAGAGAGGAGAATATGGAAAGGATTGGGGAGGAGG TGAGACAGCTGATGGAAAAGCTGAGGGAAAAGCAGTTGAGTCATAGTTTGCGGGCAGTCA GCACTGATCCCCCTCACCATGACCATCACGATGAGTTTTGCCTTATGCCCTGAATCCTGA TGGTTTCCCTGAAGTTAATAGGGAGACCCCTGCTTCCTAAACTTACACATTTGTGGTGTA CCTTTGTCGTAAACGTTTTGATGTTACCTATTTCTTGTGGGTCTCCTATTACCAGCTTCT AAATGAATGTTGTTTTTGACCCAGTTTGTAAGTTTCTGTCAGCAGGAGAGTTTTACCTAT TGCATGGAAAGATGCTCATTATATATTGTGAAGTTAATAAAACAGTTTTAAAAAGCAAAA AAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_032621 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_032621.2, NP_116010.1 |
RefSeq Size | 878 bp |
RefSeq ORF | 387 bp |
Locus ID | 84707 |
UniProt ID | Q9BXY8 |
Cytogenetics | Xq22.2 |
Domains | BEX |
Gene Summary | This gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. This gene has been found to be a tumor suppressor that is silenced in human glioma. In breast cancer cells, this gene product modulates apoptosis in response to estrogen and tamoxifen, and enhances the anti-proliferative effect of tamoxifen. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 3 and 4 encode the same isoform (3). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202129 | BEX2 (Myc-DDK-tagged)-Human brain expressed X-linked 2 (BEX2), transcript variant 3 |
USD 150.00 |
|
RC202129L3 | Lenti ORF clone of Human brain expressed X-linked 2 (BEX2), transcript variant 3, Myc-DDK-tagged |
USD 450.00 |
|
RC202129L4 | Lenti ORF clone of Human brain expressed X-linked 2 (BEX2), transcript variant 3, mGFP tagged |
USD 450.00 |
|
RG202129 | BEX2 (tGFP-tagged) - Human brain expressed X-linked 2 (BEX2), transcript variant 3 |
USD 350.00 |
|
SC104136 | BEX2 (untagged)-Human brain expressed X-linked 2 (BEX2), transcript variant 3 |
USD 150.00 |
{0} Product Review(s)
Be the first one to submit a review