CD9 (NM_001769) Human Untagged Clone

CAT#: SC322329

CD9 (untagged)-Human CD9 molecule (CD9)


  "NM_001769" in other vectors (7)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
CD9 mouse monoclonal antibody, clone OTI3D5
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD9
Synonyms BTCC-1; DRAP-27; MIC3; MRP-1; TSPAN-29; TSPAN29
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322329 CGCGCCCCCCAGTCCCGCACCCGTTCGGCCCAGGCTAAGTTAGCCCTCACCATGCCGGTC
AAAGGAGGCACCAAGTGCATCAAATACCTGCTGTTCGGATTTAACTTCATCTTCTGGCTT
GCCGGGATTGCTGTCCTTGCCATTGGACTATGGCTCCGATTCGACTCTCAGACCAAGAGC
ATCTTCGAGCAAGAAACTAATAATAATAATTCCAGCTTCTACACAGGAGTCTATATTCTG
ATCGGAGCCGGCGCCCTCATGATGCTGGTGGGCTTCCTGGGCTGCTGCGGGGCTGTGCAG
GAGTCCCAGTGCATGCTGGGACTGTTCTTCGGCTTCCTCTTGGTGATATTCGCCATTGAA
ATAGCTGCGGCCATCTGGGGATATTCCCACAAGGATGAGGTGATTAAGGAAGTCCAGGAG
TTTTACAAGGACACCTACAACAAGCTGAAAACCAAGGATGAGCCCCAGCGGGAAACGCTG
AAAGCCATCCACTATGCGTTGAACTGCTGTGGTTTGGCTGGGGGCGTGGAACAGTTTATC
TCAGACATCTGCCCCAAGAAGGACGTACTCGAAACCTTCACCGTGAAGTCCTGTCCTGAT
GCCATCAAAGAGGTCTTCGACAATAAATTCCACATCATCGGCGCAGTGGGCATCGGCATT
GCCGTGGTCATGATATTTGGCATGATCTTCAGTACGATCTTGTGCTGTGCTATCCGCAGG
AACCGCGAGATGGTCTAGAGTCAGCTTACATCCCTGAGCAGGAAAGTTTACCCATGAAGA
TTGGTGGGATTTTTTGTTTGTTTGTTTTGTTTTGTTTGTTGTTTGTTGTTTGTTTTTTTG
CCACTAATTTTAGTATTCATTCTGCATTGCTAGATAAAAGCTGAAGTTACTTTATGTTTG
TCTTTTAATGCTTCATTCAATATTGACATTTGTAGTTGAGCGGGGGGTTTGGTTTGCTTT
GGTTTATATTTTTTCAGTTGTTTGTTTTTGCTTGTTATATTAAGCAGAAATCCTGCAATG
AAAGGTACTATATTTGCTAGACTCTAGACAAGATATTGTACATAAAAGAATTTTTTTGTC
TTTAAATAGATACAAATGTCTATCAACTTTAATCAAGTTGTAACTTATATTGAAGACAAT
TTGATACATAATAAAAAATTATGACAATGTCAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001769
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001769.2, NP_001760.1
RefSeq Size 1246 bp
RefSeq ORF 687 bp
Locus ID 928
UniProt ID P21926
Cytogenetics 12p13.31
Domains transmembrane4
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Hematopoietic cell lineage
Gene Summary This gene encodes a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins are cell surface glycoproteins with four transmembrane domains that form multimeric complexes with other cell surface proteins. The encoded protein functions in many cellular processes including differentiation, adhesion, and signal transduction, and expression of this gene plays a critical role in the suppression of cancer cell motility and metastasis. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.