NDNL2 (NSMCE3) (NM_138704) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NDNL2 |
Synonyms | HCA4; LICS; MAGEG1; MAGEL3; NDNL2; NSE3 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_138704, the custom clone sequence may differ by one or more nucleotides
ATGTTGCAAAAACCGAGGAACCGGGGCCGCTCTGGCGGCCAGGCCGAGAGGGACAGAGACTGGAGCCATA GCGGAAACCCCGGGGCTTCGCGGGCCGGGGAAGACGCCCGGGTTCTCAGAGACGGCTTTGCCGAGGAGGC CCCGAGCACGTCCCGCGGGCCGGGCGGCTCGCAGGGGTCGCAGGGCCCCTCGCCTCAGGGCGCCCGCCGG GCCCAGGCCGCCCCCGCCGTGGGGCCCAGGAGCCAGAAGCAGCTGGAGCTGAAAGTGTCCGAGCTGGTGC AGTTCTTGCTGATTAAAGACCAGAAGAAGATTCCGATCAAGCGGGCCGACATACTGAAGCACGTCATCGG GGACTACAAGGACATCTTCCCCGACCTCTTCAAACGGGCCGCCGAGCGCCTCCAGTACGTCTTCGGGTAT AAGCTGGTGGAACTTGAACCCAAGAGCAACACTTACATCCTCATCAACACCCTGGAGCCTGTGGAGGAGG ATGCCGAGATGAGGGGTGACCAAGGCACGCCCACTACGGGCCTCCTGATGATCGTCTTAGGGCTCATCTT TATGAAGGGCAACACCATCAAGGAAACTGAAGCCTGGGACTTTCTGCGGCGCTTAGGGGTCTACCCCACC AAGAAGCATTTAATTTTCGGAGATCCAAAGAAACTCATTACTGAGGACTTTGTGCGACAGCGTTACCTGG AATACCGGCGGATACCCCACACCGACCCCGTCGACTACGAATTCCAGTGGGGCCCGCGAACCAACCTGGA AACCAGCAAGATGAAAGTTCTTAAGTTTGTGGCCAAGGTCCATAATCAAGACCCCAAGGACTGGCCAGCG CAGTACTGTGAGGCTTTGGCAGATGAGGAGAACAGGGCCAGACCTCAGCCTAGTGGCCCAGCTCCATCCT CTTGA |
Restriction Sites | Please inquire |
ACCN | NM_138704 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_138704.2, NP_619649.1 |
RefSeq Size | 1748 bp |
RefSeq ORF | 915 bp |
Locus ID | 56160 |
UniProt ID | Q96MG7 |
Cytogenetics | 15q13.1 |
Domains | MAGE |
Gene Summary | The protein encoded by this gene is part of the SMC5-6 chromatin reorganizing complex and is a member of the MAGE superfamily. This is an intronless gene. [provided by RefSeq, May 2011] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208815 | NDNL2 (Myc-DDK-tagged)-Human necdin-like 2 (NDNL2) |
USD 300.00 |
|
RC208815L3 | Lenti-ORF clone of NDNL2 (Myc-DDK-tagged)-Human necdin-like 2 (NDNL2) |
USD 600.00 |
|
RC208815L4 | Lenti-ORF clone of NDNL2 (mGFP-tagged)-Human necdin-like 2 (NDNL2) |
USD 600.00 |
|
RG208815 | NDNL2 (tGFP-tagged) - Human necdin-like 2 (NDNL2) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review