HAS3 (NM_138612) Human Untagged Clone

CAT#: SC321764

HAS3 (untagged)-Human hyaluronan synthase 3 (HAS3), transcript variant 2


  "NM_138612" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


HAS3 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "HAS3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HAS3
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_138612.1 GGAGGGGCATGGAGCCGCCGCGGGCCTGCTGAGCTCCGGAGCGCGGCAGCCGGCGGCACG
ATGCCGGTGCAGCTGACGACAGCCCTGCGTGTGGTGGGCACCAGCCTGTTTGCCCTGGCA
GTGCTGGGTGGCATCCTGGCAGCCTATGTGACGGGCTACCAGTTCATCCACACGGAAAAG
CACTACCTGTCCTTCGGCCTGTACGGCGCCATCCTGGGCCTGCACCTGCTCATTCAGAGC
CTTTTTGCCTTCCTGGAGCACCGGCGCATGCGACGTGCCGGCCAGGCCCTGAAGCTGCCC
TCCCCGCGGCGGGGCTCGGTGGCACTGTGCATTGCCGCGTACCAGGAGGACCCTGACTAC
TTGCGCAAGTGCCTGCGCTCGGCCCAGCGCATCTCCTTCCCTGACCTCAAGGTGGTCATG
GTGGTGGATGGCAACCGCCAGGAGGACGCCTACATGCTGGACATCTTCCACGAGGTGCTG
GGCGGCACCGAGCAGGCCGGCTTCTTTGTGTGGCGCAGCAACTTCCATGAGGCAGGCGAG
GGTGAGACGGAGGCCAGCCTGCAGGAGGGCATGGACCGTGTGCGGGATGTGGTGCGGGCC
AGCACCTTCTCGTGCATCATGCAGAAGTGGGGAGGCAAGCGCGAGGTCATGTACACGGCC
TTCAAGGCCCTCGGCGATTCGGTGGACTACATCCAGGTGTGCGACTCTGACACTGTGCTG
GATCCAGCCTGCACCATCGAGATGCTTCGAGTCCTGGAGGAGGATCCCCAAGTAGGGGGA
GTCGGGGGAGATGTCCAGCCCCCAGGGAAAGGTATGGCAGTAGAGGATGACCAGGTCCAA
GCTGCCCAGGTCAGAGCTACGGAAGCATGGTCCGTTCACCAACGCCACGTTTCTAGAGAG
CAGTGAGCTGATTCTCCAATGGTGAGCAGGGGACTACATGTGAACTGGGACCTGCAGGCC
AATGTATCCCTGAGGAAAAGTCCACAAGAACAATTCAAGAAACTAGTAAGAAACAATGGG
CAGAAAGCTGTGGGACGAAAGCACAGCAGGCTTCTGGGAGGCTGGAGATCCTTTCTCTCA
AGGGCAGGATTATTCCCACCTGCCACAGTTCACATGCCACAAATAACATCTCACCTTCAG
TCAAGAAAAACGCAAAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_138612
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138612.1, NP_619515.1
RefSeq Size 1229 bp
RefSeq ORF 846 bp
Locus ID 3038
UniProt ID O00219
Cytogenetics 16q22.1
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is involved in the synthesis of the unbranched glycosaminoglycan hyaluronan, or hyaluronic acid, which is a major constituent of the extracellular matrix. This gene is a member of the NODC/HAS gene family. Compared to the proteins encoded by other members of this gene family, this protein appears to be more of a regulator of hyaluronan synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) contains a different 5' and 3' exon as compared to variant 3. As a result, variant 2 encodes isoform b, which has the same N-terminus but is shorter and has a different C-terminus than isoform a encoded by variant 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.