PFDN2 (NM_012394) Human Untagged Clone

CAT#: SC321686

PFDN2 (untagged)-Human prefoldin subunit 2 (PFDN2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PFDN2
• Synonyms: PFD2
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_012394.3 AACCCAGCAGGCGGCGAAGATGGCGGAGAACAGCGGTCGCGCCGGCAAGAGCAGCGGGAG
  CGGCGCGGGGAAGGGGGCGGTGTCCGCAGAGCAGGTGATTGCTGGCTTCAACCGCCTTCG
  GCAGGAACAGCGAGGCCTGGCATCCAAAGCAGCTGAGTTGGAGATGGAGTTGAATGAGCA
  CAGCCTAGTGATCGATACACTGAAGGAGGTAGATGAAACTCGTAAGTGCTACCGCATGGT
  TGGAGGAGTGCTGGTGGAGCGAACTGTCAAAGAGGTGCTGCCCGCTTTGGAGAACAACAA
  GGAGCAGATACAGAAGATCATTGAGACACTGACACAGCAGCTTCAGGCAAAGGGAAAAGA
  ACTAAATGAATTCCGGGAAAAGCACAACATTCGTCTCATGGGAGAAGATGAGAAGCCAGC
  AGCCAAGGAAAACTCAGAAGGGGCTGGGGCTAAGGCCAGCTCAGCTGGAGTGTTGGTCTC
  CTAGGGACCAAGGCCTTTGCATTTTTTTCTACCCTGACTCCCACTTCTAATTTCTCTTTA
  TTGTTATTATTATTATTTTCTCTGCTATTGTAATATTTTTTTGTTAATTAAATGTTTTGG
  TCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_012394
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_012394.3, NP_036526.2
• RefSeq Size: 668 bp
• RefSeq ORF: 465 bp
• Locus ID: 5202
• UniProt ID: Q9UHV9
• Cytogenetics: 1q23.3
• Domains: KE2
• Gene Summary: This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. [provided by RefSeq, Jul 2008]