Artemin (ARTN) (NM_057090) Human Untagged Clone
CAT#: SC321029
ARTN (untagged)-Human artemin (ARTN), transcript variant 4
"NM_057090" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | Artemin |
Synonyms | ART; ENOVIN; EVN; NBN |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_057090.1
GGGGGCTCCGCCAGCAGCAGGTCCCTCGGGCCCCAGCCCTCGCTGCCACCCGGGCCTGGA
GCCCCACACCCGAGCTGCCTCAACAGGAGGGTGGGGGAACAGCTCAACAATGGCTGATGG GCGCTCCTGGTGTTGATAGAGATGGAACTTGGACTTGGAGGCCTCTCCACGCTGTCCCAC TGCCCCTGGCCTAGGCAGCAGGCTCCACTTGGTCTCTCCGCGCAGCCTGCCCTGTGGCCC ACCCTGGCCGCTCTGGCTCTGCTGAGCAGCGTCGCAGAGGCCTCCCTGGGCTCCGCGCCC CGCAGCCCTGCCCCCCGCGAAGGCCCCCCGCCTGTCCTGGCGTCCCCCGCCGGCCACCTG CCGGGGGGACGCACGGCCCGCTGGTGCAGTGGAAGAGCCCGGCGGCCGCCGCCGCAGCCT TCTCGGCCCGCGCCCCCGCCGCCTGCACCCCCATCTGCTCTTCCCCGCGGGGGCCGCGCG GCGCGGGCTGGGGGCCCGGGCAGCCGCGCTCGGGCAGCGGGGGCGCGGGGCTGCCGCCTG CGCTCGCAGCTGGTGCCGGTGCGCGCGCTCGGCCTGGGCCACCGCTCCGACGAGCTGGTG CGTTTCCGCTTCTGCAGCGGCTCCTGCCGCCGCGCGCGCTCTCCACACGACCTCAGCCTG GCCAGCCTACTGGGCGCCGGGGCCCTGCGACCGCCCCCGGGCTCCCGGCCCGTCAGCCAG CCCTGCTGCCGACCCACGCGCTACGAAGCGGTCTCCTTCATGGACGTCAACAGCACCTGG AGAACCGTGGACCGCCTCTCCGCCACCGCCTGCGGCTGCCTGGGCTGAGGGCTCGCTCCA GGGCTTTGCAGACTGGACCCTTACCGGTGGCTCTTCCTGCCTGGGACCCTCCCGCAGAGT CCCACTAGCCAGCGGCCTCAGCCAGGGACGAAGGCCTCAAAGCTGAGAGGCCCCTGCCGG TGGGTGATGGATATCATCCCCGAACAGGTGAAGGGACAACTGACTAGCAGCCCCAGAGCC CTCACCCTGCGGATCCCAGCCTAAAAGACACCAGAGACCTCAGCTATGGAGCCCTTCGGA CCCACTTCTCACAGACTCTGGCACTGGCCAGGCCTCGAACCTGGGACCCCTCCTCTGATG AACACTACAGTGGCTGAGGCATCAGCCCCCGCCCAGGCCCTGTAGGGACAGCATTTGAAG GACACATATTGCAGTTGCTTGGTTGAAAGTGCCTGTGCTGGAACTGGCCTGTACTCACTC ATGGGAGCTGGCCCCTATTTATTATTTCTAAGTTATTTATTTAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_057090 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_057090.1, NP_476431.1 |
RefSeq Size | 1162 bp |
RefSeq ORF | 687 bp |
Locus ID | 9048 |
UniProt ID | Q5T4W7 |
Cytogenetics | 1p34.1 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene encodes a secreted ligand of the glial cell line-derived neurotrophic factor (GDNF) subfamily and TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein signals through the RET receptor and GFR alpha 3 coreceptor, and supports the survival of a number of peripheral neuron populations and at least one population of dopaminergic CNS neurons. This protein has also been shown to promote tumor growth, metastasis, and drug resistance in mammary carcinoma. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (4) uses an alternate in-frame splice site in the coding region, compared to variant 2. The encoded isoform (3) is longer and lacks a predicted signal peptide compared to isoform 1. Both variants 4 and 5 encode the same isoform (3). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209122 | ARTN (Myc-DDK-tagged)-Human artemin (ARTN), transcript variant 4 |
USD 300.00 |
|
RC209122L1 | Lenti-ORF clone of ARTN (Myc-DDK-tagged)-Human artemin (ARTN), transcript variant 4 |
USD 600.00 |
|
RC209122L2 | Lenti-ORF clone of ARTN (mGFP-tagged)-Human artemin (ARTN), transcript variant 4 |
USD 600.00 |
|
RC209122L3 | Lenti-ORF clone of ARTN (Myc-DDK-tagged)-Human artemin (ARTN), transcript variant 4 |
USD 600.00 |
|
RC209122L4 | Lenti-ORF clone of ARTN (mGFP-tagged)-Human artemin (ARTN), transcript variant 4 |
USD 600.00 |
|
RG209122 | ARTN (tGFP-tagged) - Human artemin (ARTN), transcript variant 4 |
USD 500.00 |
|
SC305736 | ARTN (untagged)-Human artemin (ARTN), transcript variant 4 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review