AKR1A1 (NM_153326) Human Untagged Clone
CAT#: SC320758
AKR1A1 (untagged)-Human aldo-keto reductase family 1, member A1 (aldehyde reductase) (AKR1A1), transcript variant 2
"NM_153326" in other vectors (5)
Product Images
USD 447.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AKR1A1 |
Synonyms | ALDR1; ALR; ARM; DD3; HEL-S-6 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_153326.1
ACTTAAGCTGAGGATCGTTGGATCTCTGGCGGGGTGCAGAACTGAGCCCAGGCCACAGTA
CCCTATTCACGCTCTGTGCTTGTGCCAAGGGGGCAATGGCGGCTTCCTGTGTTCTACTGC ACACTGGGCAGAAGATGCCTCTGATTGGTCTGGGTACCTGGAAGAGTGAGCCTGGTCAGG TAAAAGCAGCTGTTAAGTATGCCCTTAGCGTAGGCTACCGCCACATTGATTGTGCTGCTA TCTACGGCAATGAGCCTGAGATTGGGGAGGCCCTGAAGGAGGACGTGGGACCAGGCAAGG CGGTGCCTCGGGAGGAGCTGTTTGTGACATCCAAGCTGTGGAACACCAAGCACCACCCCG AGGATGTGGAGCCTGCCCTCCGGAAGACTCTGGCTGACCTCCAGCTGGAGTATCTGGACC TGTACCTGATGCACTGGCCTTATGCCTTTGAGCGGGGAGACAACCCCTTCCCCAAGAATG CTGATGGGACTATATGCTACGACTCCACCCACTACAAGGAGACTTGGAAGGCTCTGGAGG CACTGGTGGCTAAGGGGCTGGTGCAGGCGCTGGGCCTGTCCAACTTCAACAGTCGGCAGA TTGATGACATACTCAGTGTGGCCTCCGTGCGTCCAGCTGTCTTGCAGGTGGAGTGCCACC CATACTTGGCTCAAAATGAGCTAATTGCCCACTGCCAAGCACGTGGCCTGGAGGTAACTG CTTATAGCCCTTTGGGCTCCTCTGATCGTGCATGGCGTGATCCTGATGAGCCTGTCCTGC TGGAGGAACCAGTAGTCCTGGCATTGGCTGAAAAGTATGGCCGATCTCCAGCTCAGATCT TGCTCAGGTGGCAGGTCCAGCGGAAAGTGATCTGCATCCCCAAAAGTATCACTCCTTCTC GAATCCTTCAGAACATCAAGGTGTTTGACTTCACCTTTAGCCCAGAAGAGATGAAGCAGC TAAATGCCCTGAACAAAAATTGGAGATATATTGTGCCTATGCTTACGGTGGATGGGAAGA GAGTCCCAAGGGATGCAGGGCATCCTCTGTACCCCTTTAATGACCCGTACTGAGACCACA GCTTCTTGGCCTCCCTTCCAGCTCTGCAGCTAATGAGGTCCTGCCACAACGGAAAGAGGG AGTTAATAAAGCCATTGGAGCACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_153326 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_153326.1, NP_697021.1 |
RefSeq Size | 1437 bp |
RefSeq ORF | 978 bp |
Locus ID | 10327 |
UniProt ID | P14550 |
Cytogenetics | 1p34.1 |
Domains | aldo_ket_red |
Protein Families | Druggable Genome |
Protein Pathways | Glycerolipid metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways |
Gene Summary | This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member, also known as aldehyde reductase, is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue. Multiple alternatively spliced transcript variants of this gene exist, all encoding the same protein. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR, compared to variant 1. All variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202813 | AKR1A1 (Myc-DDK-tagged)-Human aldo-keto reductase family 1, member A1 (aldehyde reductase) (AKR1A1), transcript variant 2 |
USD 300.00 |
|
RC202813L3 | Lenti ORF clone of Human aldo-keto reductase family 1, member A1 (aldehyde reductase) (AKR1A1), transcript variant 2, Myc-DDK-tagged |
USD 600.00 |
|
RC202813L4 | Lenti ORF clone of Human aldo-keto reductase family 1, member A1 (aldehyde reductase) (AKR1A1), transcript variant 2, mGFP tagged |
USD 600.00 |
|
RG202813 | AKR1A1 (tGFP-tagged) - Human aldo-keto reductase family 1, member A1 (aldehyde reductase) (AKR1A1), transcript variant 2 |
USD 500.00 |
|
SC100538 | AKR1A1 (untagged)-Human aldo-keto reductase family 1, member A1 (aldehyde reductase) (AKR1A1), transcript variant 2 |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review