Mimitin (NDUFAF2) (NM_174889) Human Untagged Clone

CAT#: SC320112

NDUFAF2 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2 (NDUFAF2), nuclear gene encoding mitochondrial protein

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Mimitin
• Synonyms: B17.2L; MC1DN10; mimitin; MMTN; NDUFA12L
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_174889.2 AGCGGGTCCCGCTGCTGGCAGCGCTGGAAACTGGGTGGACGGCATGGGTTGGTCTCAGGA
  TTTGTTCCGCGCCTTGTGGAGATCGCTGTCAAGGGAAGTGAAGGAGCACGTGGGCACGGA
  CCAATTCGGGAACAAATACTACTACATCCCGCAGTACAAGAACTGGAGAGGACAAACTAT
  TCGAGAGAAAAGAATTGTAGAAGCAGCAAATAAAAAAGAAGTAGACTATGAAGCAGGGGA
  TATTCCAACAGAATGGGAAGCTTGGATTAGAAGAACAAGAAAGACTCCACCTACTATGGA
  GGAAATACTAAAGAATGAAAAACACAGAGAAGAAATCAAAATAAAAAGCCAAGATTTTTA
  TGAAAAAGAAAAACTCCTTAGTAAAGAGACCAGTGAGGAACTCCTGCCTCCACCAGTTCA
  AACTCAAATTAAAGGCCATGCCTCTGCTCCATACTTTGGAAAGGAAGAACCCTCAGTGGC
  TCCCAGCAGCACTGGTAAAACCTTTCAGCCAGGATCCTGGATGCCACGAGATGGCAAGAG
  CCACAATCAATGAATGCATTATGGTCAAATCTTTTCATGTATATGGATGTGACTATTTTA
  ACAAATAAAAGAAGTGAAAAGTTAAAAAAAAAAAGAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_174889
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_174889.2, NP_777549.1
• RefSeq Size: 650 bp
• RefSeq ORF: 510 bp
• Locus ID: 91942
• UniProt ID: Q8N183
• Cytogenetics: 5q12.1
• Gene Summary: NADH:ubiquinone oxidoreductase (complex I) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. This gene encodes a complex I assembly factor. Mutations in this gene cause progressive encephalopathy resulting from mitochondrial complex I deficiency. [provided by RefSeq, Jul 2008]