C19orf56 (WDR83OS) (NM_016145) Human Untagged Clone

CAT#: SC319778

WDR83OS (untagged)-Human chromosome 19 open reading frame 56 (C19orf56)


  "NM_016145" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-C19orf56 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "C19orf56"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol C19orf56
Synonyms ASTERIX; C19orf56; PTD008
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_016145.1 CTGGCCTTCGACTCGCTATGTCCACTAACAATATGTCGGACCCACGGAGGCCGAACAAAG
TGCTGAGGTACAAGCCCCCGCCGAGCGAATGTAACCCGGCCTTGGACGACCCGACGCCGG
ACTACATGAACCTGCTGGGCATGATCTTCAGCATGTGCGGCCTCATGCTTAAGCTGAAGT
GGTGTGCTTGGGTCGCTGTCTACTGCTCCTTCATCAGCTTTGCCAACTCTCGGAGCTCGG
AGGACACGAAGCAAATGATGAGTAGCTTCATGCTGTCCATCTCTGCCGTGGTGATGTCCT
ATCTGCAGAATCCTCAGCCCATGACGCCCCCATGGTGATACCAGCCTAGAAGGGTCACAT
TTTGGACCCTGTCTATCCACTAGGCCTGGGCTTTGGCTGCTAAACCTGCTGCCTTCAGCT
GCCATCCTGGACTTCCCTGAATGAGGCCGTCTCGGTGCCCCCAGCTGGATAGAGGGAACC
TGGCCCTTTCCTAGGGAACACCCTAGGCTTACCCCTCCTGCCTCCCTTCCCCTGCCTGCT
GCTGGGGGAGATGCTGTCCATGTTTCTAGGGGTATTCATTTGCTTTCTCGTTGAAACCTG
TTGTTAATAAAGTTTTTCACTCTGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
A
Restriction Sites Please inquire     
ACCN NM_016145
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016145.1, NP_057229.1
RefSeq Size 870 bp
RefSeq ORF 321 bp
Locus ID 51398
UniProt ID Q9Y284
Cytogenetics 19p13.13
Domains UPF0139
Protein Families Transmembrane
Gene Summary Component of the PAT complex, an endoplasmic reticulum (ER)-resident membrane multiprotein complex that facilitates multi-pass membrane proteins insertion into membranes (PubMed:32814900). The PAT complex acts as an intramembrane chaperone by directly interacting with nascent transmembrane domains (TMDs), releasing its substrates upon correct folding, and is needed for optimal biogenesis of multi-pass membrane proteins (PubMed:32814900). WDR83OS/Asterix is the substrate-interacting subunit of the PAT complex, whereas CCDC47 is required to maintain the stability of WDR83OS/Asterix (PubMed:12475939, PubMed:32814900). WDR83OS/Asterix associates with the first transmembrane domain (TMD1) of the nascent chain, independently of the N-glycosylation of the chain and irrespective of the amino acid sequence and transmembrane topology of TMD1 (PubMed:12475939, PubMed:32814900). The PAT complex favors the binding to TMDs with exposed hydrophilic amino acids within the lipid bilayer and provides a membrane-embedded partially hydrophilic environment in which TMD1 binds (PubMed:32814900).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.