C19orf56 (WDR83OS) (NM_016145) Human Untagged Clone
CAT#: SC319778
WDR83OS (untagged)-Human chromosome 19 open reading frame 56 (C19orf56)
"NM_016145" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | C19orf56 |
Synonyms | ASTERIX; C19orf56; PTD008 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_016145.1
CTGGCCTTCGACTCGCTATGTCCACTAACAATATGTCGGACCCACGGAGGCCGAACAAAG
TGCTGAGGTACAAGCCCCCGCCGAGCGAATGTAACCCGGCCTTGGACGACCCGACGCCGG ACTACATGAACCTGCTGGGCATGATCTTCAGCATGTGCGGCCTCATGCTTAAGCTGAAGT GGTGTGCTTGGGTCGCTGTCTACTGCTCCTTCATCAGCTTTGCCAACTCTCGGAGCTCGG AGGACACGAAGCAAATGATGAGTAGCTTCATGCTGTCCATCTCTGCCGTGGTGATGTCCT ATCTGCAGAATCCTCAGCCCATGACGCCCCCATGGTGATACCAGCCTAGAAGGGTCACAT TTTGGACCCTGTCTATCCACTAGGCCTGGGCTTTGGCTGCTAAACCTGCTGCCTTCAGCT GCCATCCTGGACTTCCCTGAATGAGGCCGTCTCGGTGCCCCCAGCTGGATAGAGGGAACC TGGCCCTTTCCTAGGGAACACCCTAGGCTTACCCCTCCTGCCTCCCTTCCCCTGCCTGCT GCTGGGGGAGATGCTGTCCATGTTTCTAGGGGTATTCATTTGCTTTCTCGTTGAAACCTG TTGTTAATAAAGTTTTTCACTCTGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A |
Restriction Sites | Please inquire |
ACCN | NM_016145 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_016145.1, NP_057229.1 |
RefSeq Size | 870 bp |
RefSeq ORF | 321 bp |
Locus ID | 51398 |
UniProt ID | Q9Y284 |
Cytogenetics | 19p13.13 |
Domains | UPF0139 |
Protein Families | Transmembrane |
Gene Summary | Component of the PAT complex, an endoplasmic reticulum (ER)-resident membrane multiprotein complex that facilitates multi-pass membrane proteins insertion into membranes (PubMed:32814900). The PAT complex acts as an intramembrane chaperone by directly interacting with nascent transmembrane domains (TMDs), releasing its substrates upon correct folding, and is needed for optimal biogenesis of multi-pass membrane proteins (PubMed:32814900). WDR83OS/Asterix is the substrate-interacting subunit of the PAT complex, whereas CCDC47 is required to maintain the stability of WDR83OS/Asterix (PubMed:12475939, PubMed:32814900). WDR83OS/Asterix associates with the first transmembrane domain (TMD1) of the nascent chain, independently of the N-glycosylation of the chain and irrespective of the amino acid sequence and transmembrane topology of TMD1 (PubMed:12475939, PubMed:32814900). The PAT complex favors the binding to TMDs with exposed hydrophilic amino acids within the lipid bilayer and provides a membrane-embedded partially hydrophilic environment in which TMD1 binds (PubMed:32814900).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208318 | WDR83OS (Myc-DDK-tagged)-Human chromosome 19 open reading frame 56 (C19orf56) |
USD 150.00 |
|
RC208318L3 | Lenti ORF clone of Human chromosome 19 open reading frame 56 (C19orf56), Myc-DDK-tagged |
USD 450.00 |
|
RC208318L4 | Lenti ORF clone of Human chromosome 19 open reading frame 56 (C19orf56), mGFP tagged |
USD 450.00 |
|
RG208318 | WDR83OS (tGFP-tagged) - Human chromosome 19 open reading frame 56 (C19orf56) |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review