GDF15 (NM_004864) Human Untagged Clone
CAT#: SC319494
GDF15 (untagged)-Human growth differentiation factor 15 (GDF15)
"NM_004864" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GDF15 |
Synonyms | GDF-15; MIC-1; MIC1; NAG-1; PDF; PLAB; PTGFB |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004864.1
CCGCAACCTGCACAGCCATGCCCGGGCAAGAACTCAGGACGGTGAATGGCTCTCAGATGC
TCCTGGTGTTGCTGGTGCTCTCGTGGCTGCCGCATGGGGGCGCCCTGTCTCTGGCCGAGG CGAGCCGCGCAAGTTTCCCGGGACCCTCAGAGTTGCACTCCGAAGACTCCAGATTCCGAG AGTTGCGGAAACGCTACGAGGACCTGCTAACCAGGCTGCGGGCCAACCAGAGCTGGGAAG ATTCGAACACCGACCTCGTCCCGGCCCCTGCAGTCCGGATACTCACGCCAGAAGTGCGGC TGGGATCCGGCGGCCACCTGCACCTGCGTATCTCTCGGGCCGCCCTTCCCGAGGGGCTCC CCGAGGCCTCCCGCCTTCACCGGGCTCTGTTCCGGCTGTCCCCGACGGCGTCAAGGTCGT GGGACGTGACACGACCGCTGCGGCGTCAGCTCAGCCTTGCAAGACCCCAGGCGCCCGCGC TGCACCTGCGACTGTCGCCGCCGCCGTCGCAGTCGGACCAACTGCTGGCAGAATCTTCGT CCGCACGGCCCCAGCTGGAGTTGCACTTGCGGCCGCAAGCCGCCAGGGGGCGCCGCAGAG CGCGTGCGCGCAACGGGGACCACTGTCCGCTCGGGCCCGGGCGTTGCTGCCGTCTGCACA CGGTCCGCGCGTCGCTGGAAGACCTGGGCTGGGCCGATTGGGTGCTGTCGCCACGGGAGG TGCAAGTGACCATGTGCATCGGCGCGTGCCCGAGCCAGTTCCGGGCGGCAAACATGCACG CGCAGATCAAGACGAGCCTGCACCGCCTGAAGCCCGACACGGTGCCAGCGCCCTGCTGCG TGCCCGCCAGCTACAATCCCATGGTGCTCATTCAAAAGACCGACACCGGGGTGTCGCTCC AGACCTATGATGACTTGTTAGCCAAAGACTGCCACTGCATATGAGCAGTCCTGGTCCTTC CACTGTGCACCTGCGCGGAGGACGCGACCTCAGTTGTCCTGCCCTGTGGAATGGGCTCAA GGTTCCTGAGACACCCGATTCCTGCCCAAACAGCTGTATTTATATAAGTCTGTTATTTAT TATTAATTTATTGGGGTGACCTTCTTGGGGACTCGGGGGCTGGTCTGATGGAACTGTGTA TTTATTTAAAACTCTGGTGATAAAAATAAAGCTGTCTGAACTGTTAAAAAAAAAAAAAAA AAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004864 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004864.1, NP_004855.1 |
RefSeq Size | 1204 bp |
RefSeq ORF | 927 bp |
Locus ID | 9518 |
UniProt ID | Q99988 |
Cytogenetics | 19p13.11 |
Domains | TGF-beta |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The protein is expressed in a broad range of cell types, acts as a pleiotropic cytokine and is involved in the stress response program of cells after cellular injury. Increased protein levels are associated with disease states such as tissue hypoxia, inflammation, acute injury and oxidative stress. [provided by RefSeq, Aug 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201295 | GDF15 (Myc-DDK-tagged)-Human growth differentiation factor 15 (GDF15) |
USD 450.00 |
|
RC201295L1 | Lenti ORF clone of Human growth differentiation factor 15 (GDF15), Myc-DDK-tagged |
USD 750.00 |
|
RC201295L2 | Lenti ORF clone of Human growth differentiation factor 15 (GDF15), mGFP tagged |
USD 750.00 |
|
RC201295L3 | Lenti ORF clone of Human growth differentiation factor 15 (GDF15), Myc-DDK-tagged |
USD 750.00 |
|
RC201295L4 | Lenti ORF clone of Human growth differentiation factor 15 (GDF15), mGFP tagged |
USD 750.00 |
|
RG201295 | GDF15 (tGFP-tagged) - Human growth differentiation factor 15 (GDF15) |
USD 650.00 |
{0} Product Review(s)
Be the first one to submit a review