MRPS2 (NM_016034) Human Untagged Clone

CAT#: SC319219

MRPS2 (untagged)-Human mitochondrial ribosomal protein S2 (MRPS2), nuclear gene encoding mitochondrial protein


  "NM_016034" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
MRPS2 mouse monoclonal antibody, clone OTI4D6 (formerly 4D6)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "MRPS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MRPS2
Synonyms CGI-91; COXPD36; MRP-S2; S2mt
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_016034.2 GCCCCGCGTCCCAGCCATGGCGACATCCTCGGCCGCGCTGCCCCGAATACTCGGCGCGGG
TGCCCGGGCCCCGTCGCGCTGGTTGGGCTTTCTCGGGAAGGCGACCCCCCGGCCTGCTCG
GCCGAGCCGCAGGACGCTTGGAAGCGCGACGGCCCTTATGATCCGCGAGTCGGAGGACAG
CACCGATTTCAACGACAAGATTTTGAATGAGCCCCTCAAGCACTCTGACTTCTTCAATGT
CAAGGAACTGTTTTCCGTGAGAAGCCTCTTCGATGCCCGAGTCCATCTGGGACACAAAGC
TGGCTGTCGGCACAGGTTTATGGAGCCGTACATCTTTGGGAGCCGCCTGGACCACGACAT
CATCGACCTGGAACAGACAGCCACGCACCTCCAGCTGGCCTTGAACTTCACCGCCCACAT
GGCCTACCGCAAGGGCATCATCTTGTTTATAAGCCGCAACCGGCAGTTCTCGTACCTGAT
TGAGAACATGGCCCGTGACTGTGGCGAGTACGCCCACACTCGCTACTTCAGGGGCGGCAT
GCTGACCAACGCGCGCCTCCTCTTTGGCCCCACGGTCCGCCTGCCGGACCTCATCATCTT
CCTGCACACGCTCAACAACATCTTTGAGCCACACGTGGCCGTGAGAGACGCAGCCAAGAT
GAACATCCCCACAGTGGGCATCGTGGACACCAACTGCAACCCCTGCCTCATCACCTACCC
TGTACCCGGCAATGACGACTCTCCGCTGGCTGTGCACCTCTACTGCAGGCTCTTCCAGAC
GGCCATCACCCGGGCCAAGGAGAAGCGGCAGCAGGTTGAGGCTCTCTATCGCCTGCAGGG
CCAGAAGGAGCCCGGGGACCAGGGGCCAGCCCACCCTCCTGGGGCTGACATGAGCCATTC
CCTGTGATGTTCACTCTCCTCCCAAAGCAAACCACAGCCAAGCCTGTCTGAGCTGGGAGT
CCCCTTCCCCAGCCCTGGGTCAGCGGCATCCTCAGTCGTTGTTACTTACTCAGCTGATGT
CACAGTGCAGACATCCACCGTTCCACCACAGAACCAGTGGCTGAGCGGACCAACGTTGCC
ATGTGCGTTTGCTCTGTGGGGAACAGAGCACAGAGGGTGAGCGACATGTGCAGAACGGCC
CCTTGGCTGCAGTTAGGACCTCAGTGGCTGGTATGGCCGAGCTGCTAGAAGATGCTGCTG
TCCCTGTGATCCCAGCAGCCCTCCCTTCACCGTGACCCCTGACCTTTGTCAGGAAGGTGC
AGTTTTTCTTCTCAATCTAAATGCCTTTCAGGTGGGCCGCTTCCTTGGCTACCTGGTTCC
AGGGGGCTGTTTTGTAATGAGATGCTGCTGGCAGGCCACTCAGAGGCTCCCAGCTGGGTT
GGTGGGACAGCCAGGCCAGATGACCTGATTCCAGCAAAAATAAAACTCAGATTTGGGCAA
AATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAC
Restriction Sites Please inquire     
ACCN NM_016034
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016034.2, NP_057118.1
RefSeq Size 1434 bp
RefSeq ORF 891 bp
Locus ID 51116
UniProt ID Q9Y399
Cytogenetics 9q34.3
Domains Ribosomal_S2
Gene Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S2 family. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (1) represents the shortest transcript and is protein-coding. Sequence Note: A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species, a strong Kozak signal and on the presence of a predicted mitochondrial targeting sequence in the protein N-terminus. An upstream in-frame start codon is also present but has a weaker Kozak signal and is poorly conserved, and use of the upstream start codon would result in a protein that is 23 aa longer at the N-terminus and lacks a predicted mitochondrial targeting sequence. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.