MRPS2 (NM_016034) Human Untagged Clone
CAT#: SC319219
MRPS2 (untagged)-Human mitochondrial ribosomal protein S2 (MRPS2), nuclear gene encoding mitochondrial protein
"NM_016034" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MRPS2 |
Synonyms | CGI-91; COXPD36; MRP-S2; S2mt |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_016034.2
GCCCCGCGTCCCAGCCATGGCGACATCCTCGGCCGCGCTGCCCCGAATACTCGGCGCGGG
TGCCCGGGCCCCGTCGCGCTGGTTGGGCTTTCTCGGGAAGGCGACCCCCCGGCCTGCTCG GCCGAGCCGCAGGACGCTTGGAAGCGCGACGGCCCTTATGATCCGCGAGTCGGAGGACAG CACCGATTTCAACGACAAGATTTTGAATGAGCCCCTCAAGCACTCTGACTTCTTCAATGT CAAGGAACTGTTTTCCGTGAGAAGCCTCTTCGATGCCCGAGTCCATCTGGGACACAAAGC TGGCTGTCGGCACAGGTTTATGGAGCCGTACATCTTTGGGAGCCGCCTGGACCACGACAT CATCGACCTGGAACAGACAGCCACGCACCTCCAGCTGGCCTTGAACTTCACCGCCCACAT GGCCTACCGCAAGGGCATCATCTTGTTTATAAGCCGCAACCGGCAGTTCTCGTACCTGAT TGAGAACATGGCCCGTGACTGTGGCGAGTACGCCCACACTCGCTACTTCAGGGGCGGCAT GCTGACCAACGCGCGCCTCCTCTTTGGCCCCACGGTCCGCCTGCCGGACCTCATCATCTT CCTGCACACGCTCAACAACATCTTTGAGCCACACGTGGCCGTGAGAGACGCAGCCAAGAT GAACATCCCCACAGTGGGCATCGTGGACACCAACTGCAACCCCTGCCTCATCACCTACCC TGTACCCGGCAATGACGACTCTCCGCTGGCTGTGCACCTCTACTGCAGGCTCTTCCAGAC GGCCATCACCCGGGCCAAGGAGAAGCGGCAGCAGGTTGAGGCTCTCTATCGCCTGCAGGG CCAGAAGGAGCCCGGGGACCAGGGGCCAGCCCACCCTCCTGGGGCTGACATGAGCCATTC CCTGTGATGTTCACTCTCCTCCCAAAGCAAACCACAGCCAAGCCTGTCTGAGCTGGGAGT CCCCTTCCCCAGCCCTGGGTCAGCGGCATCCTCAGTCGTTGTTACTTACTCAGCTGATGT CACAGTGCAGACATCCACCGTTCCACCACAGAACCAGTGGCTGAGCGGACCAACGTTGCC ATGTGCGTTTGCTCTGTGGGGAACAGAGCACAGAGGGTGAGCGACATGTGCAGAACGGCC CCTTGGCTGCAGTTAGGACCTCAGTGGCTGGTATGGCCGAGCTGCTAGAAGATGCTGCTG TCCCTGTGATCCCAGCAGCCCTCCCTTCACCGTGACCCCTGACCTTTGTCAGGAAGGTGC AGTTTTTCTTCTCAATCTAAATGCCTTTCAGGTGGGCCGCTTCCTTGGCTACCTGGTTCC AGGGGGCTGTTTTGTAATGAGATGCTGCTGGCAGGCCACTCAGAGGCTCCCAGCTGGGTT GGTGGGACAGCCAGGCCAGATGACCTGATTCCAGCAAAAATAAAACTCAGATTTGGGCAA AATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAC |
Restriction Sites | Please inquire |
ACCN | NM_016034 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_016034.2, NP_057118.1 |
RefSeq Size | 1434 bp |
RefSeq ORF | 891 bp |
Locus ID | 51116 |
UniProt ID | Q9Y399 |
Cytogenetics | 9q34.3 |
Domains | Ribosomal_S2 |
Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S2 family. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012] Transcript Variant: This variant (1) represents the shortest transcript and is protein-coding. Sequence Note: A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species, a strong Kozak signal and on the presence of a predicted mitochondrial targeting sequence in the protein N-terminus. An upstream in-frame start codon is also present but has a weaker Kozak signal and is poorly conserved, and use of the upstream start codon would result in a protein that is 23 aa longer at the N-terminus and lacks a predicted mitochondrial targeting sequence. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203579 | MRPS2 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein S2 (MRPS2), nuclear gene encoding mitochondrial protein |
USD 300.00 |
|
RC203579L3 | Lenti ORF clone of Human mitochondrial ribosomal protein S2 (MRPS2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 600.00 |
|
RC203579L4 | Lenti ORF clone of Human mitochondrial ribosomal protein S2 (MRPS2), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 600.00 |
|
RG203579 | MRPS2 (tGFP-tagged) - Human mitochondrial ribosomal protein S2 (MRPS2), nuclear gene encoding mitochondrial protein |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review