Centlein (CNTLN) (NM_001114395) Human Untagged Clone

CAT#: SC318849

CNTLN (untagged)-Human centlein, centrosomal protein (CNTLN), transcript variant 2


  "NM_001114395" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


CNTLN rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "CNTLN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CNTLN
Synonyms bA340N12.1; C9orf39; C9orf101
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001114395, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGCGTTCGCCTCCCTCACCGCACCCTTCGCCCCCAGCGCGACAGCTGGGCCCC
AGGTCCCCACGTGTTGGGCGGGGAGCTGAAGTACACGCAATGCGCAGCGAGGCCTCGGGT
TTTGCCGGCGCAGCGCGGGAGGTGGTCGCGGACGAAAGTGATAAAATCTGGGTGGGTGAA
GAAGGGTCAGGGGGCCGGCGAGGGCCTGGGGGGGCAGCTCCGGCTCATGCTCCCCTCCTC
AGCGCGCCCATGGGGTCCAGACGGCTAGAGGGCATCTCGGTAGAGGAGGCGATGGTGACC
CGGACGCAGCTGCTGGAGGAAGAGCTGAGCAGCCTAAAGGAGGAGTTGGCCCTGTGTCAG
GCTGATAAAGAATTTGTATGGTCTTTGTGGAAACGTCTCCAGGTTACAAACCCAGATCTC
ACACAAGTGGTCAGTTTGGTTGTGGAAAGAGAAAAACAGAAATCTGAAGCTAAAGACAGA
AAAGTTCTAGAAATTCTGCAAGTCAAGGATGCCAAAATACAAGAATTTGAACAGAGAGAG
TCAGTACTGAAACAGGAAATAAATGACCTTGTAAAACGGAAAATTGCAGTAGATGAAGAA
AATGCTTTCTTAAGGAAAGAATTCAGTGACTTGGAGAAGAAATTTAAAGATAAAAGTCAA
GAAATTAAGGACACTAAGGAGTGTGTACAGAACAAAGAAGAGCAAAACAGACTAGTTATA
AAAAATCTGGAGGAGGAAAACAAGAAATTAAGTACCCGCTGCACTGACCTGCTAAATGAC
CTGGAGAAATTGAGGAAGCAGGAAGCACATTTGAGAAAAGAAAAATATAGCACTGATGCA
AAAATAAAGACCTTTGAAGACAATTTAATTGAAGCAAGGAAAGAAGTTGAAGTATCACAG
AGTAAATACAATGCTCTATCATTACAGTTGAGTAATAAACAGACTGAACTTATCCAGAAG
GATATGGATATTACCCTGGTCAGGAAGGAACTGCAGGAGCTGCAGAATCTTTACAAACAG
AACAGTACACATACAGCCCAGCAAGCAGAGCTGATCCAGCAGCTTCAGGTTCTCAATATG
GACACACAAAAAGTACTGAGAAATCAGGAAGATGTTCACACAGCTGAAAGTATATCATAT
CAAAAAGTATGCTTTTATTCTGTAATAAAGATG
Restriction Sites Please inquire     
ACCN NM_001114395
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001114395.1, NP_001107867.1
RefSeq Size 4887 bp
RefSeq ORF 1176 bp
Locus ID 54875
UniProt ID Q9NXG0
Cytogenetics 9p22.2
Gene Summary Required for centrosome cohesion and recruitment of CEP68 to centrosomes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks several exons in the central and 3' regions but includes an alternate 3' terminal exon, and it thus differs in its 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is significantly shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.