TAF8 (NM_138572) Human Untagged Clone

CAT#: SC317466

TAF8 (untagged)-Human TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa (TAF8)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TAF8
• Synonyms: II; TAF; TAF(II)43; TAFII-43; TAFII43; TBN
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC317466 representing NM_138572.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCCGACGCGGCGGCCACAGCTGGGGCCGGTGGCTCCGGAACGAGATCGGGAAGTAAACAGTCCACT
  AACCCTGCCGATAACTATCATCTGGCCCGGAGGAGAACCCTGCAGGTGGTTGTGAGCTCCTTGCTGACA
  GAGGCAGGGTTTGAGAGTGCCGAGAAAGCATCCGTGGAAACGCTGACAGAGATGCTGCAGAGCTACATT
  TCAGAAATTGGGAGAAGTGCCAAGTCTTACTGTGAGCACACAGCCAGGACCCAGCCCACACTGTCCGAT
  ATCGTGGTCACACTTGTTGAGATGGGTTTCAATGTGGACACTCTCCCTGCTTATGCAAAACGGTCTCAG
  AGGATGGTCATCACTGCTCCTCCGGTGACCAATCAGCCAGTGACCCCCAAGGCCCTCACTGCAGGGCAG
  AACCGACCCCACCCGCCGCACATCCCCAGCCATTTTCCTGAGTTCCCTGATCCCCACACCTACATCAAA
  ACTCCGACGTACCGTGAGCCCGTGTCAGACTACCAGGTCCTGCGGGAGAAGGCTGCATCCCAGAGGCGC
  GATGTGGAGCGGGCACTTACCCGTTTCATGGCCAAGACAGGCGAGACTCAGAGTCTTTTCAAAGATGAC
  GTCAGCACATTTCCATTGATTGCTGCCAGACCTTTCACCATCCCCTACCTGACAGCTCTTCTTCCGTCT
  GAACTGGAGATGCAACAAATGGAAGAGACAGATTCCTCGGAGCAGGATGAACAGACAGACACAGAGAAC
  CTTGCTCTTCATATCAGCATGGAGGATTCTGGAGCCGAGAAGGAGAACACCTCTGTCCTGCAGCAGAAC
  CCCTCCTTGTCGGGTAGCCGGAATGGGGAGGAGAACATCATCGATAACCCTTATCTGCGGCCGGTGAAG
  AAGCCCAAGATCCGCAGGAAGAAGTCCCTCTCCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_138572
• Insert Size: 933 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_138572.2
• RefSeq Size: 4323 bp
• RefSeq ORF: 933 bp
• Locus ID: 129685
• UniProt ID: Q7Z7C8
• Cytogenetics: 6p21.1
• MW: 34.3 kDa
• Gene Summary: This gene encodes one of several TATA-binding protein (TBP)-associated factors (TAFs), which are integral subunits of the general transcription factor complex TFIID. TFIID recognizes the core promoter of many genes and nucleates the assembly of a transcription preinitiation complex containing RNA polymerase II and other initiation factors. The protein encoded by this gene contains an H4-like histone fold domain, and interacts with several subunits of TFIID including TBP and the histone-fold protein TAF10. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]