FHL2 (NM_201557) Human Untagged Clone

CAT#: SC317400

FHL2 (untagged)-Human four and a half LIM domains 2 (FHL2), transcript variant 4


  "NM_201557" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-FHL2 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "FHL2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FHL2
Synonyms AAG11; DRAL; FHL-2; SLIM-3; SLIM3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317400 representing NM_201557.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACTGAGCGCTTTGACTGCCACCATTGCAACGAATCTCTCTTTGGCAAGAAGTACATCCTGCGGGAG
GAGAGCCCCTACTGCGTGGTGTGCTTTGAGACCCTGTTCGCCAACACCTGCGAGGAGTGTGGGAAGCCC
ATCGGCTGTGACTGCAAGGACTTGTCTTACAAGGACCGGCACTGGCATGAAGCCTGTTTCCACTGCTCG
CAGTGCAGAAACTCACTGGTGGACAAGCCCTTTGCTGCCAAGGAGGACCAGCTGCTCTGTACAGACTGC
TATTCCAACGAGTACTCATCCAAGTGCCAGGAATGCAAGAAGACCATCATGCCAGGTACCCGCAAGATG
GAGTACAAGGGCAGCAGCTGGCATGAGACCTGCTTCATCTGCCACCGCTGCCAGCAGCCAATTGGAACC
AAGAGTTTCATCCCCAAAGACAATCAGAATTTCTGTGTGCCCTGCTATGAGAAACAACATGCCATGCAG
TGCGTTCAGTGCAAAAAGCCCATCACCACGGGAGGGGTCACTTACCGGGAGCAGCCCTGGCACAAGGAG
TGCTTCGTGTGCACCGCCTGCAGGAAGCAGCTGTCTGGGCAGCGCTTCACAGCTCGCGATGACTTTGCC
TACTGCCTGAACTGCTTCTGTGACTTGTATGCCAAGAAGTGTGCTGGGTGCACCAACCCCATCAGCGGA
CTTGGTGGCACAAAATACATCTCCTTTGAGGAACGGCAGTGGCATAACGACTGCTTTAACTGTAAGAAG
TGCTCCCTCTCACTGGTGGGGCGTGGCTTCCTCACAGAGAGGGACGACATCCTGTGCCCCGACTGTGGG
AAAGACATCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_201557
Insert Size 840 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_201557.3
RefSeq Size 1727 bp
RefSeq ORF 840 bp
Locus ID 2274
UniProt ID Q14192
Cytogenetics 2q12.2
Protein Families Druggable Genome
MW 32.2 kDa
Gene Summary This gene encodes a member of the four-and-a-half-LIM-only protein family. Family members contain two highly conserved, tandemly arranged, zinc finger domains with four highly conserved cysteines binding a zinc atom in each zinc finger. This protein is thought to have a role in the assembly of extracellular membranes. Also, this gene is down-regulated during transformation of normal myoblasts to rhabdomyosarcoma cells and the encoded protein may function as a link between presenilin-2 and an intracellular signaling pathway. Multiple alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 2. Variants 1, 2, 4, 5, 6, 7, and 8 all encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.