PPCDC (NM_021823) Human Untagged Clone

CAT#: SC317303

PPCDC (untagged)-Human phosphopantothenoylcysteine decarboxylase (PPCDC)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPCDC
• Synonyms: coaC; MDS018; PPC-DC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC317303 representing NM_021823.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAACCAAAGGCCTCCTGTCCAGCTGCTGCACCCTTGATGGAGAGAAAATTCCATGTTCTTGTGGGT
  GTCACGGGGAGTGTCGCAGCCCTGAAGTTGCCTCTTCTGGTGTCAAAGCTTTTGGACATTCCTGGGCTG
  GAAGTAGCAGTGGTCACAACTGAGAGAGCCAAACATTTCTACAGCCCCCAGGACATTCCTGTCACCCTC
  TACAGCGACGCTGATGAATGGGAGATATGGAAGAGCCGCTCTGACCCAGTTCTGCACATTGACCTGCGG
  AGGTGGGCAGACCTCCTGCTGGTGGCTCCTCTTGATGCCAACACTCTGGGGAAGGTGGCCAGTGGCATC
  TGTGACAACTTGCTTACCTGCGTCATGCGGGCCTGGGACCGCAGCAAGCCCCTGCTCTTCTGCCCGGCC
  ATGAACACCGCCATGTGGGAGCACCCGATCACAGCGCAGCAGGTAGACCAGCTCAAGGCCTTTGGCTAT
  GTCGAGATCCCCTGTGTGGCCAAGAAGCTGGTGTGCGGAGATGAAGGTCTCGGGGCCATGGCTGAAGTG
  GGGACCATCGTGGACAAAGTGAAAGAAGTCCTCTTCCAGCACAGTGGCTTCCAGCAGAGTTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_021823
• Insert Size: 615 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021823.4
• RefSeq Size: 2268 bp
• RefSeq ORF: 615 bp
• Locus ID: 60490
• UniProt ID: Q96CD2
• Cytogenetics: 15q24.2
• Domains: Flavoprotein
• Protein Pathways: Metabolic pathways, Pantothenate and CoA biosynthesis
• MW: 22.4 kDa
• Gene Summary: Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).