LCN10 (NM_001001712) Human Untagged Clone

CAT#: SC317298

LCN10 (untagged)-Human lipocalin 10 (LCN10)


  "NM_001001712" in other vectors (6)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "LCN10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LCN10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317298 representing NM_001001712.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGCAGGGGCTGCTGGTGCTGGCGCTGGTGCTGGTGCTGGTGCTAGTGCTGGCTGCAGGGTCCCAG
GTGCAGGAGTGGTACCCCAGGGAGTCCCACGCCCTCAACTGGAACAAGTTTTCAGGGTTCTGGTACATT
CTGGCCACTGCCACTGATGCCCAGGGATTCTTGCCGGCCAGGGACAAGAGGAAGCTGGGGGCGTCCGTG
GTAAAGGTGAACAAAGTGGGCCAGCTCCGCGTGCTCCTCGCCTTCAGACGGTTGAAGGGGTGCCAGTCC
CAGGAGGTGATCCTGAGGAAAGACGGGAAGAAGCCGGTGTTTGGGAACGCCTGTGCATACGCGGCGGGC
CCGAGGGAAGGACAGGAGGGAGTGAAAGGGGTGAAGGCCTTCCACGTGCTGTCCACTGACTACAGCTAC
GGCTTGGTCTACCTCCGCCTGGGGCGTGCAACCCAAAACTACAAGAACCTGCTGCTCTTCCATAGGCAG
AATGTTTCGAGCTTCCAGAGTCTGAAGGAATTCATGGACGCTTGTGACATTCTGGGGCTCTCCAAGGCC
GCCGTCATCCTCCCGAAAGACGCGTCCCGTACACACACCATCCTGCCATGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001001712
Insert Size 603 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001001712.2
RefSeq Size 2047 bp
RefSeq ORF 603 bp
Locus ID 414332
UniProt ID Q6JVE6
Cytogenetics 9q34.3
Protein Families Secreted Protein, Transmembrane
MW 22.2 kDa
Gene Summary Members of the lipocalin family, such as LCN10, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]).[supplied by OMIM, Aug 2009]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.