KBTBD13 (NM_001101362) Human Untagged Clone

CAT#: SC317094

KBTBD13 (untagged)-Human kelch repeat and BTB (POZ) domain containing 13 (KBTBD13)


  "NM_001101362" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "KBTBD13"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KBTBD13
Synonyms HCG1645727; NEM6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001101362, the custom clone sequence may differ by one or more nucleotides
ATGGCACGGGGTCCACAGACCCTGGTGCAGGTGTGGGTGGGCGGCCAGCTCTTCCAAGCC
GACCGCGCCCTGCTGGTGGAGCACTGTGGCTTCTTCCGAGGCCTCTTCCGCTCCGGCATG
CGGGAGACCCGCGCAGCAGAGGTGCGCCTGGGCGTTCTGAGCGCGGGAGGTTTCCGCGCC
ACGCTGCAGGTGCTGCGCGGCGACCGGCCGGCGCTGGCGGCGGAGGACGAGCTGCTGCAG
GCCGTGGAGTGCGCCGCCTTCCTCCAGGCGCCGGCGCTGGCTCGCTTTCTGGAGCACAAC
CTCACGTCGGACAACTGCGCATTGCTGTGCGACGCGGCCGCCGCCTTCGGCCTGCGCGAC
GTGTTCCACAGTGCCGCGCTCTTCATCTGCGACGGCGAGCGCGAGCTGGCGGCCGAACTG
GCGCTGCCTGAGGCCCGCGCCTACGTGGCGGCCCTGCGGCCCAGCAGCTACGCGGCCGTG
AGCACGCACACGCCCGCGCCCGGCTTCCTGGAGGACGCCTCGCGCACGCTGTGTTACCTG
GACGAGGAAGAGGACGCGTGGCGCACGCTGGCTGCGCTGCCCCTGGAGGCCAGCACGTTG
CTGGCCGGGGTGGCCACGCTGGGCAACAAGCTTTACATCGTGGGGGGCGTGCGCGGCGCC
AGCAAGGAGGTGGTAGAGCTGGGCTTCTGCTACGACCCCGACGGCGGCACGTGGCACGAG
TTCCCCAGCCCGCACCAGCCGCGCTATGACACAGCGCTGGCCGGCTTCGACGGCCGCCTC
TACGCCATCGGCGGCGAGTTCCAGAGGACGCCCATCAGCTCCGTGGAGCGCTACGACCCA
GCCGCGGGCTGCTGGAGTTTCGTGGCCGACCTGCCGCAGCCGGCCGCCGGCGTGCCCTGC
GCCCAGGCTTGTGGCCGTCTCTTCGTGTGCCTGTGGCGGCCGGCCGACACCACCGCCGTG
GTGGAGTACGCAGTGCGGACCGACGCGTGGCTGCCAGTGGCCGAGCTGCGGCGTCCGCAG
AGCTATGGCCACTGCATGGTGGCCCACCGCGACAGCCTCTATGTGGTGCGCAACGGACCT
TCCGACGACTTCCTGCACTGCGCCATCGACTGTCTCAACCTGGCCACGGGCCAGTGGACG
GCGCTGCCCGGCCAGTTCGTCAACAGCAAGGGAGCGCTCTTCACGGCCGTGGTGCGCGGC
GACACCGTCTATACGGTCAACCGCATGTTCACGCTGCTCTACGCCATCGAGGGCGGCACC
TGGCGGCTGCTCAGGGAGAAAGCCGGCTTCCCGCGGCCCGGCTCCTTGCAGACCTTTCTC
CTAAGGCTGCCTCCTGGCGCTCCTGGGCCTGTGACTTCGACAACGGCAGAACTG
Restriction Sites Please inquire     
ACCN NM_001101362
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001101362.1, NP_001094832.1
RefSeq Size 1377 bp
RefSeq ORF 1377 bp
Locus ID 390594
UniProt ID C9JR72
Cytogenetics 15q22.31
Gene Summary The gene belongs to a family of genes encoding proteins containing a BTB domain and several kelch repeats. The BTB domain functions as a protein-protein interaction module, which includes an ability to self-associate or to interact with non-BTB domain-containing proteins. The kelch motif typically occurs in groups of five to seven repeats, and has been found in proteins with diverse functions. Known functions of these family members include transcription regulation, ion channel tetramerization and gating, protein ubiquitination or degradation, and cytoskeleton regulation. The exact function of this family member has yet to be determined. [provided by RefSeq, Jun 2010]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.