KIAA1712 (CEP44) (NM_001040157) Human Untagged Clone

CAT#: SC317082

CEP44 (untagged)-Human centrosomal protein 44kDa (CEP44), transcript variant 1


  "NM_001040157" in other vectors (6)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
CEP44 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "KIAA1712"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KIAA1712
Synonyms KIAA1712; PS1TP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317082 representing NM_001040157.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAACAGGTGACTTAAAAAGAAGCTTACGGAACCTAGAACAGGTGCTCCGCTTGCTAAATTATCCT
GAAGAGGTGGACTGTGTAGGTTTGATAAAGGGAGACCCAGCAGCATCTTTGCCCATCATCAGCTATTCT
TTTACCTCATACTCACCTTATGTAACAGAACTTATAATGGAATCCAATGTAGAGCTCATAGCAAAAAAT
GACTTGCGCTTTATAGATGCTGTCTATAAGCTTCTTCGTGATCAATTTAATTATAAACCAATTTTGACA
AAAAAGCAGTTTATCCAATGTGGGTTTGCAGAATGGAAAATCCAAATTGTTTGTGATATTTTGAATTGT
GTGATGAAAAAGCACAAGGAATTAAGCAGTCTTCAGAAGATTCCATCACAACAAAGAAAGAAAATCAGT
TCTGGTAAGTCAGAACCTCCTTTGGGCAATGAGAAAATATCTGCAGAGGCTGTTGGCGTTGATATCAGT
GGCAGGTTTATGACCTCAGGAAAGAAGAAAGCTGTGGTGATTCGTCACTTGTATAATGAAGATAATGTT
GACATTTCTGAGGATACATTAAGTCCAATAACAGATGTTAATGAAGCAGTTGATGTGTCTGACTTAAAT
GCTACTGAAATAAAGATGCCTGAAGTAAAGGTTCCTGAAATCAAGGCTGAGCAACAGGATGTAAATGTT
AATCCTGAGATTACTGCACTACAAACTATGCTTGCTGAATGCCAAGAAAATCTTAAGAAACTGACTTCG
ATAGAGAAAAGGTTAGACTGTTTGGAACAAAAAATGAAAGGAAAAGTGATGGTAGATGAAAACACCTGG
ACTAATCTTCTTAGTCGTGTCACTCTTCTTGAAACAGAAATGCTTTTGTCTAAAAAGAATGATGAATTT
ATAGAGTTTAATGAAGTTAGTGAAGACTACGCTTCTTGTAGTGACATGGACCTTCTGAATCCTCACAGA
AAAAGCGAAGTAGAGAGGCCAGCAAGTATTCCTCTGTCCTCTGGCTATAGTACAGCATCATCAGATTCA
ACTCCCAGAGCCTCTACTGTTAATTACTGTGGTTTGAATGAGATTTCAGAGGAAACAACAATCCAGAAA
ATGGAAAGGATGAAAAAAATGTTTGAAGAAACTGCAGAGTTACTGAAATGTCCAAATCACTACTTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001040157
Insert Size 1173 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001040157.2
RefSeq Size 4535 bp
RefSeq ORF 1173 bp
Locus ID 80817
UniProt ID Q9C0F1
Cytogenetics 4q34.1
MW 44.1 kDa
Gene Summary Centriole-enriched microtubule-binding protein involved in centriole biogenesis. In collaboration with CEP295 and POC1B, is required for the centriole-to-centrosome conversion by ensuring the formation of bona fide centriole wall (PubMed:32060285). Functions as a linker component that maintains centrosome cohesion. Associates with CROCC and regulates its stability and localization to the centrosome (PubMed:31974111).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript but encodes the shorter isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.