TMEM273 (NM_001010863) Human Untagged Clone

CAT#: SC316892

C10orf128 (untagged)-Human chromosome 10 open reading frame 128 (C10orf128)


  "NM_001010863" in other vectors (4)

Reconstitution Protocol

USD 150.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "TMEM273"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM273
Synonyms C10orf128
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001010863 edited
ATGAACTTGGGGGTCAGCATGCTGAGGATCCTCTTCCTCCTGGATGTAGGAGGAGCTCAA
GTGCTGGCAACAGGCAAGACCCCTGGGGCTGAAATTGATTTCAAGTACGCCCTCATCGGG
ACTGCTGTGGGTGTCGCCATATCTGCTGGCTTCCTGGCCCTGAAGATCTGCATGATCAGG
AGGCACTTATTTGACGACGACTCTTCCGACCTGAAAAGCACGCCTGGGGGCCTCAGTGAC
ACCATCCCGCTAAAGAAGAGAGCCCCAAGGCGAAACCACAATTTCTCCAAAAGAGATGCA
CAGGTGATTGAGCTGTAG
Restriction Sites Please inquire     
ACCN NM_001010863
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001010863.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001010863.1, NP_001010863.1
RefSeq Size 384 bp
RefSeq ORF 318 bp
Locus ID 170371
UniProt ID Q5T292
Cytogenetics 10q11.23
Protein Families Transmembrane

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.